ID: 1023998875

View in Genome Browser
Species Human (GRCh38)
Location 7:45178095-45178117
Sequence CTCTCCTTACAGCTGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023998870_1023998875 -6 Left 1023998870 7:45178078-45178100 CCTGGAGGGTGCTCCACCTCTCC 0: 1
1: 0
2: 2
3: 18
4: 225
Right 1023998875 7:45178095-45178117 CTCTCCTTACAGCTGGAGCTGGG No data
1023998860_1023998875 26 Left 1023998860 7:45178046-45178068 CCAGGGGGTGCCCTGGCCTGGGG 0: 1
1: 0
2: 13
3: 76
4: 634
Right 1023998875 7:45178095-45178117 CTCTCCTTACAGCTGGAGCTGGG No data
1023998869_1023998875 -1 Left 1023998869 7:45178073-45178095 CCTTGCCTGGAGGGTGCTCCACC 0: 1
1: 0
2: 2
3: 14
4: 235
Right 1023998875 7:45178095-45178117 CTCTCCTTACAGCTGGAGCTGGG No data
1023998858_1023998875 27 Left 1023998858 7:45178045-45178067 CCCAGGGGGTGCCCTGGCCTGGG 0: 1
1: 2
2: 7
3: 50
4: 450
Right 1023998875 7:45178095-45178117 CTCTCCTTACAGCTGGAGCTGGG No data
1023998866_1023998875 10 Left 1023998866 7:45178062-45178084 CCTGGGGGATGCCTTGCCTGGAG 0: 1
1: 1
2: 0
3: 22
4: 228
Right 1023998875 7:45178095-45178117 CTCTCCTTACAGCTGGAGCTGGG No data
1023998856_1023998875 28 Left 1023998856 7:45178044-45178066 CCCCAGGGGGTGCCCTGGCCTGG 0: 1
1: 1
2: 7
3: 44
4: 464
Right 1023998875 7:45178095-45178117 CTCTCCTTACAGCTGGAGCTGGG No data
1023998863_1023998875 16 Left 1023998863 7:45178056-45178078 CCCTGGCCTGGGGGATGCCTTGC 0: 1
1: 0
2: 4
3: 24
4: 248
Right 1023998875 7:45178095-45178117 CTCTCCTTACAGCTGGAGCTGGG No data
1023998864_1023998875 15 Left 1023998864 7:45178057-45178079 CCTGGCCTGGGGGATGCCTTGCC 0: 1
1: 0
2: 0
3: 21
4: 273
Right 1023998875 7:45178095-45178117 CTCTCCTTACAGCTGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023998875 Original CRISPR CTCTCCTTACAGCTGGAGCT GGG Intronic
No off target data available for this crispr