ID: 1024000819

View in Genome Browser
Species Human (GRCh38)
Location 7:45188340-45188362
Sequence AATGCCTCCCCCAGTGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024000819_1024000820 13 Left 1024000819 7:45188340-45188362 CCTTACTCACTGGGGGAGGCATT No data
Right 1024000820 7:45188376-45188398 GATTTGAATTTTTCAACTGATGG No data
1024000819_1024000821 14 Left 1024000819 7:45188340-45188362 CCTTACTCACTGGGGGAGGCATT No data
Right 1024000821 7:45188377-45188399 ATTTGAATTTTTCAACTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024000819 Original CRISPR AATGCCTCCCCCAGTGAGTA AGG (reversed) Intergenic
No off target data available for this crispr