ID: 1024002338

View in Genome Browser
Species Human (GRCh38)
Location 7:45199050-45199072
Sequence GGAGAGCTCCACCATGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024002338_1024002346 -1 Left 1024002338 7:45199050-45199072 CCATCCCCATGGTGGAGCTCTCC No data
Right 1024002346 7:45199072-45199094 CAGGATTGGGCAGCCACTCAAGG No data
1024002338_1024002349 12 Left 1024002338 7:45199050-45199072 CCATCCCCATGGTGGAGCTCTCC No data
Right 1024002349 7:45199085-45199107 CCACTCAAGGACCCTGGCTGTGG No data
1024002338_1024002350 18 Left 1024002338 7:45199050-45199072 CCATCCCCATGGTGGAGCTCTCC No data
Right 1024002350 7:45199091-45199113 AAGGACCCTGGCTGTGGCCATGG No data
1024002338_1024002347 6 Left 1024002338 7:45199050-45199072 CCATCCCCATGGTGGAGCTCTCC No data
Right 1024002347 7:45199079-45199101 GGGCAGCCACTCAAGGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024002338 Original CRISPR GGAGAGCTCCACCATGGGGA TGG (reversed) Intergenic
No off target data available for this crispr