ID: 1024003562

View in Genome Browser
Species Human (GRCh38)
Location 7:45208664-45208686
Sequence CAGGAAGCTGGGGCATCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024003554_1024003562 12 Left 1024003554 7:45208629-45208651 CCTCTCTATTCTACAACCTGAAA No data
Right 1024003562 7:45208664-45208686 CAGGAAGCTGGGGCATCCTAGGG No data
1024003553_1024003562 13 Left 1024003553 7:45208628-45208650 CCCTCTCTATTCTACAACCTGAA No data
Right 1024003562 7:45208664-45208686 CAGGAAGCTGGGGCATCCTAGGG No data
1024003552_1024003562 14 Left 1024003552 7:45208627-45208649 CCCCTCTCTATTCTACAACCTGA No data
Right 1024003562 7:45208664-45208686 CAGGAAGCTGGGGCATCCTAGGG No data
1024003550_1024003562 29 Left 1024003550 7:45208612-45208634 CCGTATTCTCAACTCCCCCTCTC No data
Right 1024003562 7:45208664-45208686 CAGGAAGCTGGGGCATCCTAGGG No data
1024003555_1024003562 -4 Left 1024003555 7:45208645-45208667 CCTGAAAATTCTCCTAAGACAGG No data
Right 1024003562 7:45208664-45208686 CAGGAAGCTGGGGCATCCTAGGG No data
1024003551_1024003562 15 Left 1024003551 7:45208626-45208648 CCCCCTCTCTATTCTACAACCTG No data
Right 1024003562 7:45208664-45208686 CAGGAAGCTGGGGCATCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024003562 Original CRISPR CAGGAAGCTGGGGCATCCTA GGG Intergenic
No off target data available for this crispr