ID: 1024005623

View in Genome Browser
Species Human (GRCh38)
Location 7:45223458-45223480
Sequence CAGTGAGTCCCTTTATCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024005620_1024005623 25 Left 1024005620 7:45223410-45223432 CCAAATAGCAAATATGTTTGATC No data
Right 1024005623 7:45223458-45223480 CAGTGAGTCCCTTTATCCCCCGG No data
1024005619_1024005623 26 Left 1024005619 7:45223409-45223431 CCCAAATAGCAAATATGTTTGAT No data
Right 1024005623 7:45223458-45223480 CAGTGAGTCCCTTTATCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024005623 Original CRISPR CAGTGAGTCCCTTTATCCCC CGG Intergenic
No off target data available for this crispr