ID: 1024005623 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:45223458-45223480 |
| Sequence | CAGTGAGTCCCTTTATCCCC CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1024005620_1024005623 | 25 | Left | 1024005620 | 7:45223410-45223432 | CCAAATAGCAAATATGTTTGATC | No data | ||
| Right | 1024005623 | 7:45223458-45223480 | CAGTGAGTCCCTTTATCCCCCGG | No data | ||||
| 1024005619_1024005623 | 26 | Left | 1024005619 | 7:45223409-45223431 | CCCAAATAGCAAATATGTTTGAT | No data | ||
| Right | 1024005623 | 7:45223458-45223480 | CAGTGAGTCCCTTTATCCCCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1024005623 | Original CRISPR | CAGTGAGTCCCTTTATCCCC CGG | Intergenic | ||
| No off target data available for this crispr | |||||