ID: 1024006634

View in Genome Browser
Species Human (GRCh38)
Location 7:45229142-45229164
Sequence TCTCCTTGGCACCTGCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024006625_1024006634 27 Left 1024006625 7:45229092-45229114 CCTCCAGGGCTTCGACACCTGCC No data
Right 1024006634 7:45229142-45229164 TCTCCTTGGCACCTGCAGCCAGG No data
1024006626_1024006634 24 Left 1024006626 7:45229095-45229117 CCAGGGCTTCGACACCTGCCTCT No data
Right 1024006634 7:45229142-45229164 TCTCCTTGGCACCTGCAGCCAGG No data
1024006632_1024006634 -10 Left 1024006632 7:45229129-45229151 CCCTTCGGGTCTGTCTCCTTGGC No data
Right 1024006634 7:45229142-45229164 TCTCCTTGGCACCTGCAGCCAGG No data
1024006628_1024006634 6 Left 1024006628 7:45229113-45229135 CCTCTTGTTCTTACAGCCCTTCG No data
Right 1024006634 7:45229142-45229164 TCTCCTTGGCACCTGCAGCCAGG No data
1024006627_1024006634 10 Left 1024006627 7:45229109-45229131 CCTGCCTCTTGTTCTTACAGCCC No data
Right 1024006634 7:45229142-45229164 TCTCCTTGGCACCTGCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024006634 Original CRISPR TCTCCTTGGCACCTGCAGCC AGG Intergenic
No off target data available for this crispr