ID: 1024007393

View in Genome Browser
Species Human (GRCh38)
Location 7:45236735-45236757
Sequence ATGTATGCAGAGATGGACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024007391_1024007393 25 Left 1024007391 7:45236687-45236709 CCATTTTTGTGACATCATATCTC No data
Right 1024007393 7:45236735-45236757 ATGTATGCAGAGATGGACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024007393 Original CRISPR ATGTATGCAGAGATGGACTT TGG Intergenic
No off target data available for this crispr