ID: 1024008065

View in Genome Browser
Species Human (GRCh38)
Location 7:45241827-45241849
Sequence ACTCAGAGACTGAAGGGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024008065_1024008069 -4 Left 1024008065 7:45241827-45241849 CCGTCTCCCTTCAGTCTCTGAGT No data
Right 1024008069 7:45241846-45241868 GAGTGCTGTTTGGCCCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024008065 Original CRISPR ACTCAGAGACTGAAGGGAGA CGG (reversed) Intergenic
No off target data available for this crispr