ID: 1024008069

View in Genome Browser
Species Human (GRCh38)
Location 7:45241846-45241868
Sequence GAGTGCTGTTTGGCCCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024008066_1024008069 -10 Left 1024008066 7:45241833-45241855 CCCTTCAGTCTCTGAGTGCTGTT No data
Right 1024008069 7:45241846-45241868 GAGTGCTGTTTGGCCCCAGCAGG No data
1024008063_1024008069 13 Left 1024008063 7:45241810-45241832 CCCTGTGGCTTTTTCTTCCGTCT No data
Right 1024008069 7:45241846-45241868 GAGTGCTGTTTGGCCCCAGCAGG No data
1024008064_1024008069 12 Left 1024008064 7:45241811-45241833 CCTGTGGCTTTTTCTTCCGTCTC No data
Right 1024008069 7:45241846-45241868 GAGTGCTGTTTGGCCCCAGCAGG No data
1024008065_1024008069 -4 Left 1024008065 7:45241827-45241849 CCGTCTCCCTTCAGTCTCTGAGT No data
Right 1024008069 7:45241846-45241868 GAGTGCTGTTTGGCCCCAGCAGG No data
1024008061_1024008069 29 Left 1024008061 7:45241794-45241816 CCTTCTGAGAAGCTTGCCCTGTG No data
Right 1024008069 7:45241846-45241868 GAGTGCTGTTTGGCCCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024008069 Original CRISPR GAGTGCTGTTTGGCCCCAGC AGG Intergenic
No off target data available for this crispr