ID: 1024008098

View in Genome Browser
Species Human (GRCh38)
Location 7:45242000-45242022
Sequence CATCATAGGGAGGCAGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024008098_1024008104 0 Left 1024008098 7:45242000-45242022 CCCACCACTGCCTCCCTATGATG No data
Right 1024008104 7:45242023-45242045 CTGATTGCAACAGAAACCACTGG No data
1024008098_1024008106 26 Left 1024008098 7:45242000-45242022 CCCACCACTGCCTCCCTATGATG No data
Right 1024008106 7:45242049-45242071 AATAAAAGTACAATTACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024008098 Original CRISPR CATCATAGGGAGGCAGTGGT GGG (reversed) Intergenic
No off target data available for this crispr