ID: 1024012291

View in Genome Browser
Species Human (GRCh38)
Location 7:45279381-45279403
Sequence GATCTAAGCAAATGAACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024012291_1024012293 20 Left 1024012291 7:45279381-45279403 CCTGCTGTTCATTTGCTTAGATC No data
Right 1024012293 7:45279424-45279446 CATAGTACAAAAGCTACACAAGG No data
1024012291_1024012295 29 Left 1024012291 7:45279381-45279403 CCTGCTGTTCATTTGCTTAGATC No data
Right 1024012295 7:45279433-45279455 AAAGCTACACAAGGAGAAATGGG No data
1024012291_1024012294 28 Left 1024012291 7:45279381-45279403 CCTGCTGTTCATTTGCTTAGATC No data
Right 1024012294 7:45279432-45279454 AAAAGCTACACAAGGAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024012291 Original CRISPR GATCTAAGCAAATGAACAGC AGG (reversed) Intergenic
No off target data available for this crispr