ID: 1024014748

View in Genome Browser
Species Human (GRCh38)
Location 7:45303059-45303081
Sequence TTCTAATTAGCTATCCTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024014748_1024014753 15 Left 1024014748 7:45303059-45303081 CCCACTAGGATAGCTAATTAGAA No data
Right 1024014753 7:45303097-45303119 TTTGCAAGGATAGGAGAAACTGG No data
1024014748_1024014752 6 Left 1024014748 7:45303059-45303081 CCCACTAGGATAGCTAATTAGAA No data
Right 1024014752 7:45303088-45303110 AAATAAGTTTTTGCAAGGATAGG No data
1024014748_1024014751 1 Left 1024014748 7:45303059-45303081 CCCACTAGGATAGCTAATTAGAA No data
Right 1024014751 7:45303083-45303105 ATGGAAAATAAGTTTTTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024014748 Original CRISPR TTCTAATTAGCTATCCTAGT GGG (reversed) Intergenic
No off target data available for this crispr