ID: 1024014752

View in Genome Browser
Species Human (GRCh38)
Location 7:45303088-45303110
Sequence AAATAAGTTTTTGCAAGGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024014748_1024014752 6 Left 1024014748 7:45303059-45303081 CCCACTAGGATAGCTAATTAGAA No data
Right 1024014752 7:45303088-45303110 AAATAAGTTTTTGCAAGGATAGG No data
1024014747_1024014752 16 Left 1024014747 7:45303049-45303071 CCACTTCGTACCCACTAGGATAG 0: 2
1: 8
2: 91
3: 371
4: 957
Right 1024014752 7:45303088-45303110 AAATAAGTTTTTGCAAGGATAGG No data
1024014749_1024014752 5 Left 1024014749 7:45303060-45303082 CCACTAGGATAGCTAATTAGAAA No data
Right 1024014752 7:45303088-45303110 AAATAAGTTTTTGCAAGGATAGG No data
1024014745_1024014752 29 Left 1024014745 7:45303036-45303058 CCACAATGTGATACCACTTCGTA No data
Right 1024014752 7:45303088-45303110 AAATAAGTTTTTGCAAGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024014752 Original CRISPR AAATAAGTTTTTGCAAGGAT AGG Intergenic
No off target data available for this crispr