ID: 1024014753

View in Genome Browser
Species Human (GRCh38)
Location 7:45303097-45303119
Sequence TTTGCAAGGATAGGAGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024014748_1024014753 15 Left 1024014748 7:45303059-45303081 CCCACTAGGATAGCTAATTAGAA No data
Right 1024014753 7:45303097-45303119 TTTGCAAGGATAGGAGAAACTGG No data
1024014749_1024014753 14 Left 1024014749 7:45303060-45303082 CCACTAGGATAGCTAATTAGAAA No data
Right 1024014753 7:45303097-45303119 TTTGCAAGGATAGGAGAAACTGG No data
1024014747_1024014753 25 Left 1024014747 7:45303049-45303071 CCACTTCGTACCCACTAGGATAG 0: 2
1: 8
2: 91
3: 371
4: 957
Right 1024014753 7:45303097-45303119 TTTGCAAGGATAGGAGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024014753 Original CRISPR TTTGCAAGGATAGGAGAAAC TGG Intergenic
No off target data available for this crispr