ID: 1024019897

View in Genome Browser
Species Human (GRCh38)
Location 7:45359207-45359229
Sequence CTGTAAGACTAAAAGGCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024019895_1024019897 4 Left 1024019895 7:45359180-45359202 CCAAGTAACTTTGGAAATTAATA No data
Right 1024019897 7:45359207-45359229 CTGTAAGACTAAAAGGCAGTAGG No data
1024019894_1024019897 5 Left 1024019894 7:45359179-45359201 CCCAAGTAACTTTGGAAATTAAT No data
Right 1024019897 7:45359207-45359229 CTGTAAGACTAAAAGGCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024019897 Original CRISPR CTGTAAGACTAAAAGGCAGT AGG Intergenic
No off target data available for this crispr