ID: 1024023550

View in Genome Browser
Species Human (GRCh38)
Location 7:45391896-45391918
Sequence TGCCATGGCAAATGTGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 167}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024023550_1024023556 1 Left 1024023550 7:45391896-45391918 CCTGGGCCACATTTGCCATGGCA 0: 1
1: 0
2: 1
3: 15
4: 167
Right 1024023556 7:45391920-45391942 AGGTGATAGGCACCTTGGCCTGG 0: 1
1: 0
2: 0
3: 12
4: 354
1024023550_1024023563 20 Left 1024023550 7:45391896-45391918 CCTGGGCCACATTTGCCATGGCA 0: 1
1: 0
2: 1
3: 15
4: 167
Right 1024023563 7:45391939-45391961 CTGGGGTGGGCAATCCTCAGTGG 0: 1
1: 0
2: 3
3: 14
4: 152
1024023550_1024023558 3 Left 1024023550 7:45391896-45391918 CCTGGGCCACATTTGCCATGGCA 0: 1
1: 0
2: 1
3: 15
4: 167
Right 1024023558 7:45391922-45391944 GTGATAGGCACCTTGGCCTGGGG 0: 1
1: 0
2: 0
3: 5
4: 124
1024023550_1024023559 6 Left 1024023550 7:45391896-45391918 CCTGGGCCACATTTGCCATGGCA 0: 1
1: 0
2: 1
3: 15
4: 167
Right 1024023559 7:45391925-45391947 ATAGGCACCTTGGCCTGGGGTGG 0: 1
1: 0
2: 1
3: 8
4: 169
1024023550_1024023555 -4 Left 1024023550 7:45391896-45391918 CCTGGGCCACATTTGCCATGGCA 0: 1
1: 0
2: 1
3: 15
4: 167
Right 1024023555 7:45391915-45391937 GGCAGAGGTGATAGGCACCTTGG 0: 1
1: 0
2: 0
3: 26
4: 207
1024023550_1024023557 2 Left 1024023550 7:45391896-45391918 CCTGGGCCACATTTGCCATGGCA 0: 1
1: 0
2: 1
3: 15
4: 167
Right 1024023557 7:45391921-45391943 GGTGATAGGCACCTTGGCCTGGG 0: 1
1: 0
2: 1
3: 9
4: 141
1024023550_1024023560 7 Left 1024023550 7:45391896-45391918 CCTGGGCCACATTTGCCATGGCA 0: 1
1: 0
2: 1
3: 15
4: 167
Right 1024023560 7:45391926-45391948 TAGGCACCTTGGCCTGGGGTGGG 0: 1
1: 0
2: 1
3: 24
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024023550 Original CRISPR TGCCATGGCAAATGTGGCCC AGG (reversed) Intergenic
901207099 1:7503553-7503575 TGCAAAGGCAGATGAGGCCCAGG - Intronic
906949423 1:50322446-50322468 TCCCATGGCTAATGTGGTCTTGG - Intergenic
907066666 1:51491073-51491095 TGCGATGGCAAATCAGGGCCAGG + Intronic
907231437 1:53003119-53003141 TGCCAGGACAAATGGAGCCCAGG + Intronic
907458979 1:54594090-54594112 TGCCATGGCGAGTCTGGCTCAGG + Intronic
907514473 1:54984726-54984748 TGCTGTGGCAAAGGTGGCCCAGG + Intronic
910109264 1:83665004-83665026 TGGCAGGCCACATGTGGCCCAGG + Intergenic
910413837 1:86975981-86976003 TGCCATGGCAAATGTATCTTTGG + Intronic
911519691 1:98913903-98913925 TGCCATGCCTAATGAGGCCTTGG + Intronic
911790910 1:102014392-102014414 TGCCATGGCTAAAGAGGCCAAGG + Intergenic
911900001 1:103491568-103491590 TGCCATGGTAAATCTGGCTTTGG - Intergenic
915541748 1:156571888-156571910 TGTCTTTGAAAATGTGGCCCAGG + Intronic
915971100 1:160355862-160355884 GGCCCTGGCAGATGTGGCCACGG + Exonic
917678597 1:177343392-177343414 TGCCTTTGCAGCTGTGGCCCTGG + Intergenic
918327696 1:183426163-183426185 TTCCAAGGGAAATGTGGTCCTGG + Intergenic
918488991 1:185060134-185060156 TGCTGTGGCATATGAGGCCCTGG + Intronic
919286465 1:195567758-195567780 TGCAATGATCAATGTGGCCCTGG + Intergenic
920524342 1:206655722-206655744 TGCCAGGGCAATTGTGGCTCAGG - Intronic
922554247 1:226520980-226521002 TTCCATGGCAACTGTGGCCAAGG + Intergenic
923571142 1:235115946-235115968 TGCCATAGGAACTGTGGCTCGGG + Intronic
1067410586 10:46060790-46060812 TGCCTGGGCCAAAGTGGCCCAGG + Intergenic
1070520283 10:77246813-77246835 TGCCTTGGCAATTGTGCCCTTGG + Intronic
1071575917 10:86726213-86726235 TGTCGTGCCAAGTGTGGCCCAGG - Exonic
1072435725 10:95413495-95413517 TACCCTGGCAAATGAGGGCCAGG - Intronic
1072483509 10:95831749-95831771 TGTTATGCCACATGTGGCCCAGG - Intronic
1077174248 11:1181458-1181480 TGGTAAGGCAAATGTGGCCGAGG + Intronic
1077701870 11:4449777-4449799 TGGCATGGCTGCTGTGGCCCGGG + Exonic
1077704876 11:4475243-4475265 TGGCATGGCTGCTGTGGCCCGGG + Intergenic
1077706276 11:4489338-4489360 TGGCATGGCTGCTGTGGCCCGGG + Exonic
1078053074 11:7984283-7984305 GACCCTGGCATATGTGGCCCTGG + Intronic
1081515030 11:43820476-43820498 TGCTACTGAAAATGTGGCCCTGG - Intronic
1082676018 11:56103595-56103617 TGCCTTGGCAAATGGTCCCCAGG + Intergenic
1082677255 11:56120885-56120907 TGCCTTGGCAAATGGCCCCCAGG + Intergenic
1084399900 11:68937425-68937447 TCCCATGCAACATGTGGCCCTGG + Intronic
1089121783 11:116141313-116141335 TGCCATAGAAAATATGGTCCTGG + Intergenic
1089303296 11:117511611-117511633 TGCCTTGGCATATGTGACACTGG - Intronic
1089773173 11:120817646-120817668 TGCAATTGCAAATGTATCCCAGG - Intronic
1092940934 12:13406232-13406254 TGCCATGGCAGATGCACCCCTGG - Intergenic
1097090249 12:56499116-56499138 TGCCACGGCAAGTGTGAACCAGG + Intergenic
1100362699 12:93892934-93892956 TCCCAAAGCAAATGTGGCCTTGG + Intronic
1103362413 12:120361879-120361901 TGCCATGGCAACCGGGCCCCAGG - Intronic
1103362417 12:120361892-120361914 TGCCATGGCAACGCCGGCCCCGG + Intronic
1103743898 12:123109300-123109322 TGGCATGGAAAATGGGGCCAAGG + Intronic
1108835263 13:54537874-54537896 TGTCATAGCATATGTCGCCCAGG - Intergenic
1109982183 13:69923762-69923784 TTCCATGGCAAATGTAGCCCTGG - Intronic
1114305553 14:21419885-21419907 GGCCATTGCACAGGTGGCCCTGG - Intronic
1114416651 14:22549362-22549384 TGTGATGGCACATGTGGCCAGGG + Intergenic
1115944675 14:38646222-38646244 TGACATGGCTATTGTGACCCTGG - Intergenic
1122203155 14:100134754-100134776 TGCCATGGCAGAGCTGGCCCTGG + Intronic
1123034661 14:105466978-105467000 TGTCCTGGCACGTGTGGCCCTGG + Intronic
1125399057 15:39280866-39280888 TGCCATCGCAACTGCAGCCCGGG + Intergenic
1126211212 15:46103172-46103194 TGCCATGTGAAATGTGCCCAGGG - Intergenic
1129292180 15:74576865-74576887 TGCTGTGACACATGTGGCCCTGG + Intronic
1130371559 15:83288886-83288908 GGCCATCCCAAATGTGGCCCAGG + Intergenic
1130740926 15:86599359-86599381 TTCAATGGCAAATTTGTCCCTGG - Intronic
1131039730 15:89252712-89252734 TGCTATTGTAAATGGGGCCCAGG - Intronic
1131110593 15:89762091-89762113 TGCCTTGGCCAAGGTGCCCCAGG + Intronic
1132967725 16:2668372-2668394 TGCCACGGCAAGTGTGAACCAGG + Intergenic
1133950591 16:10388525-10388547 AGCCATGGCAAAAGTTGCCAAGG + Intronic
1137589083 16:49682442-49682464 TGGCATTGCAAGTGTGGACCGGG - Intronic
1138093390 16:54194339-54194361 CGCCATGGCCCGTGTGGCCCGGG - Intergenic
1139124417 16:64060738-64060760 TTCCATGTCTTATGTGGCCCTGG - Intergenic
1139854747 16:69971386-69971408 TGCAATGGTCAATGAGGCCCTGG + Intergenic
1139883735 16:70194292-70194314 TGCAATGGTCAATGAGGCCCTGG + Intergenic
1140368778 16:74401221-74401243 TGCAATGGTCAATGAGGCCCTGG - Intergenic
1140940522 16:79717741-79717763 GGCCAGGACAAATGTGGCCCAGG - Intergenic
1141163607 16:81645577-81645599 AGCGATGGCAAGTGTTGCCCAGG + Intronic
1141674688 16:85511548-85511570 TGGCCTGGCAAATGATGCCCAGG + Intergenic
1141901883 16:86996356-86996378 GGCCATCGCAGATGTGGCCTGGG - Intergenic
1142613860 17:1124033-1124055 TGCCATGGCAACAGAGGCCGAGG - Intronic
1142951903 17:3489406-3489428 TAGCATGGCAAATCTGACCCAGG - Intronic
1143350634 17:6285625-6285647 TGCCATGCCAATTCTGGGCCTGG - Intergenic
1143947218 17:10604050-10604072 TGACATTGCAAATCTGGCCAAGG - Intergenic
1146585766 17:34080277-34080299 TGCAATGTCAATTGTGCCCCTGG + Intronic
1148178435 17:45586443-45586465 TGCCATGGCCAAAAAGGCCCTGG + Intergenic
1148222385 17:45872197-45872219 TGACAGGGCAGATGTGGCCTCGG - Intergenic
1148270725 17:46260012-46260034 TGCCATGGCCAAAAAGGCCCTGG - Intergenic
1148645530 17:49217888-49217910 TCCCATGGCCAATGTCGTCCAGG - Exonic
1148752851 17:49955500-49955522 TGCCAGGGCAAATGATGCCCAGG + Intergenic
1154198261 18:12281687-12281709 TGCCTTGGCACATGAGCCCCTGG - Intergenic
1154358869 18:13642656-13642678 AGCCCTGGCAGAGGTGGCCCGGG - Intronic
1155831218 18:30516733-30516755 TGCCAGTGAAAATGTGTCCCTGG - Intergenic
1159671445 18:71226208-71226230 TGTCATGGTGAATGTGGCCATGG + Intergenic
1162706125 19:12555908-12555930 TGGCCTGGCACATGTGGTCCTGG + Intronic
1164084417 19:21888354-21888376 TGCCACGGCAAGTGTGAACCAGG + Intergenic
1164386354 19:27773834-27773856 TGCCATGTCAAAGGTCGACCAGG + Intergenic
1168254986 19:55160269-55160291 GGGCATGTCACATGTGGCCCTGG - Intronic
926976235 2:18519576-18519598 TGCAATGTCAAATGAGTCCCTGG - Intergenic
929430465 2:41882051-41882073 TTCCATGGCAAGTTTGTCCCAGG + Intergenic
930090608 2:47528772-47528794 CGCCTTCGCAAATGGGGCCCTGG + Intronic
933587593 2:84196138-84196160 GGCCATGGCTTATGGGGCCCTGG + Intergenic
942920629 2:181369490-181369512 TGCCCTGTCACATGTGGTCCAGG + Intergenic
947838464 2:233191601-233191623 TACAATAGCAAATGTGGCCAAGG + Intronic
948130836 2:235599601-235599623 TGCCATGGCCCATGTGGCTCCGG + Intronic
948262424 2:236613939-236613961 TGCCATGTAAAATGTGCCTCTGG - Intergenic
948678387 2:239612363-239612385 AGCCATGGCCAGCGTGGCCCTGG - Intergenic
1169386491 20:5154393-5154415 TGTCAGGGCAAGTGTGTCCCAGG + Intronic
1175218548 20:57404297-57404319 TGCAAAGGCAGATGGGGCCCAGG - Intronic
1175961150 20:62637020-62637042 TGCCCTGGAACATGTTGCCCAGG - Intergenic
1176298970 21:5089572-5089594 TGCCATGGCATTTGTGGACATGG - Intergenic
1178128430 21:29542410-29542432 TTCCGTTGCAAATGTTGCCCTGG + Intronic
1179166396 21:38938525-38938547 TACCATGGCAACAGTGTCCCTGG - Intergenic
1179647708 21:42785343-42785365 TCCCATGACAAACGTGGCCCTGG - Intergenic
1179858056 21:44172377-44172399 TGCCATGGCATTTGTGGACATGG + Intergenic
1180200889 21:46223417-46223439 TTCCATGGCACATGTGGCTGGGG - Intronic
1184039627 22:41935228-41935250 TGGCAAGGAAAATGTGGCACAGG + Intergenic
1185078490 22:48696127-48696149 TGCCATGGGAGAAGTGGCGCAGG + Intronic
950497254 3:13341151-13341173 GGCCATGGCAGTTGTGGCCCAGG - Intronic
955896949 3:63710477-63710499 TGCAGTGGGAAATGTGGCACTGG + Intergenic
956665224 3:71636137-71636159 TGTCATAGTAATTGTGGCCCCGG - Intergenic
958057763 3:88435011-88435033 TCCCATGTCAGATGTGGCCTAGG + Intergenic
961176945 3:124843308-124843330 TGCCCTGGCCTATGTGGCTCTGG + Intronic
961403272 3:126662115-126662137 AGCCATGGCAGTCGTGGCCCGGG + Intergenic
962212326 3:133489736-133489758 TGCCAGGTCAATAGTGGCCCAGG - Intergenic
963207517 3:142651857-142651879 TGCCAAGAGAAATGAGGCCCAGG - Intronic
968581832 4:1398879-1398901 TGCCATGGCAATGGTGTGCCTGG - Intergenic
971680404 4:29691730-29691752 TGCCATGGCGAATGTGGAGAGGG - Intergenic
973768777 4:54187913-54187935 TGCCATGGGTAGGGTGGCCCTGG + Intronic
975856152 4:78626737-78626759 TGTCATTGCAAATGTATCCCAGG - Intergenic
976107298 4:81632796-81632818 TGCTGTGGAAAATGTGGCCTTGG - Intronic
978892551 4:113847499-113847521 TGCTATAGCAACTGTGTCCCTGG + Intergenic
980611189 4:135166099-135166121 TGCTTTTGCAAGTGTGGCCCAGG - Intergenic
982496396 4:156098843-156098865 TCCCATGGCAAGTGTGGGGCCGG + Intergenic
984296981 4:177864935-177864957 AGCTATGGCAGATGTGGCCAAGG + Intronic
984701235 4:182819922-182819944 TGCCATGGCCTATCTGGGCCTGG + Intergenic
985297613 4:188452385-188452407 TGCCGTGTCCAGTGTGGCCCAGG + Intergenic
986715916 5:10523554-10523576 TGCCCTGGCTAATGTGGGCTTGG - Intergenic
987775338 5:22358610-22358632 TTCCTTTCCAAATGTGGCCCAGG + Intronic
988452817 5:31360283-31360305 TGCCATGGCAATTGGAGCCTTGG - Intergenic
988531365 5:32030169-32030191 GGAAATGGAAAATGTGGCCCAGG - Intronic
990699793 5:58461819-58461841 TGCCACCCCAAATATGGCCCTGG - Intergenic
991117276 5:62969398-62969420 TGTCATGGCAAATGGGAGCCAGG + Intergenic
992564723 5:77986088-77986110 TGGCATTGCACATGTTGCCCAGG + Intergenic
993200198 5:84806038-84806060 TGCCGTGGCACATGTGGCTATGG - Intergenic
993980734 5:94540475-94540497 TGCCATCACAATGGTGGCCCAGG + Intronic
995496800 5:112754172-112754194 TGCTATGGCATATGTGGTCTTGG - Intronic
998266701 5:140672451-140672473 TGCCATGGCCAAAAAGGCCCTGG - Exonic
998739602 5:145185452-145185474 TGAAATGAAAAATGTGGCCCTGG + Intergenic
1001277305 5:170360119-170360141 TGGCATGGCAAAGGAGGCCCTGG - Intronic
1002604847 5:180376591-180376613 TGCTATGGCAACCATGGCCCAGG - Intergenic
1006846937 6:37068923-37068945 TGCCCTGGCACTTGTGGCCAGGG - Intergenic
1010999839 6:82575575-82575597 TGCTATTGCAGATGTGGCCAAGG + Intergenic
1012896244 6:104953230-104953252 CGCGATGGCAAACGTCGCCCTGG - Intergenic
1013283442 6:108660374-108660396 TGATAAGGCAAATGTTGCCCAGG - Intronic
1016268152 6:142256385-142256407 TGCAATAGTAAATGTGGCTCTGG + Intergenic
1016796293 6:148121465-148121487 TGACATGGCAACAGTGTCCCAGG - Intergenic
1017712610 6:157183738-157183760 TGCAAAGGCAAATGAGCCCCTGG - Intronic
1017890604 6:158635569-158635591 TGCCATGTCTAATGTGGCCTGGG + Intergenic
1018044421 6:159953165-159953187 TGCCATGGCGAATCAGGCTCAGG - Intergenic
1021582744 7:22174425-22174447 TGCCATAGGAGATGTGGCCCTGG - Intronic
1021663860 7:22952554-22952576 TGCTATGGCATATGTGATCCTGG - Intronic
1022323365 7:29307804-29307826 GGCCATGTGGAATGTGGCCCAGG + Intronic
1024023550 7:45391896-45391918 TGCCATGGCAAATGTGGCCCAGG - Intergenic
1025747946 7:64261911-64261933 TGCAATGGCAATTTTGGCTCAGG + Intronic
1025875464 7:65476863-65476885 TGCGATGGCAAACGTTGTCCAGG - Intergenic
1028456250 7:91041058-91041080 TGCCCTGGCAGGTGTGGCCCAGG - Intronic
1030189834 7:106800011-106800033 TGCCATCACAACGGTGGCCCGGG - Intergenic
1031123256 7:117744876-117744898 GGCCAGGGCAAATGTAGACCAGG - Intronic
1035972811 8:4270394-4270416 AGCCAAGGCAAGTGTGGCCGAGG - Intronic
1037613955 8:20500454-20500476 TGCCATGGCATTTATGGCACTGG - Intergenic
1044728580 8:95212741-95212763 TGCAATGGCTACTGTGGGCCTGG + Intergenic
1045605586 8:103770134-103770156 TGGCAAGTCAAATTTGGCCCAGG - Intronic
1046732238 8:117738198-117738220 TGCCAAGGCAAGTGTTGCTCAGG - Intergenic
1047883138 8:129218501-129218523 TGCCAAGGGAAATTTGGCCTAGG + Intergenic
1049880421 8:145058289-145058311 TACCATGGCAACTATGGACCAGG - Intergenic
1050138483 9:2493267-2493289 TGCCAGAGCAGATGTGGCCTTGG - Intergenic
1050524124 9:6530707-6530729 TGCCATGGCAACTGCAGACCTGG - Intergenic
1051231114 9:14956717-14956739 TACCATGACAAATGTGGCTGGGG + Intergenic
1051791334 9:20806084-20806106 TGACATGGCAAGAGTGGTCCAGG - Intronic
1055925929 9:81509771-81509793 TCCCAGGGCTTATGTGGCCCAGG - Intergenic
1056644559 9:88399530-88399552 ATCCTTGGCAAATGTAGCCCAGG + Intronic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1057562655 9:96140350-96140372 TGCCTTTGCAAATGGGGGCCTGG - Intergenic
1058567152 9:106298325-106298347 TGCCATGGGTAATCTAGCCCTGG + Intergenic
1060767591 9:126306711-126306733 GGCTGTGGGAAATGTGGCCCTGG + Intergenic
1061623046 9:131824150-131824172 TCCCATGACAAAAGTGGCGCTGG - Intergenic
1189304130 X:39974044-39974066 TGCCAGGGGCTATGTGGCCCGGG + Intergenic
1196783989 X:119406484-119406506 TCCACTGGGAAATGTGGCCCAGG - Exonic
1201707720 Y:16955092-16955114 TGCCATCGCAACTGTGGACCAGG - Intergenic
1201862428 Y:18613974-18613996 TGCTTTGGCCAATGTAGCCCTGG + Intergenic
1201863864 Y:18628750-18628772 TGCTTTGGCCAATGTAGCCCTGG + Intergenic
1201869458 Y:18691628-18691650 TGCTTTGGCCAATGTAGCCCTGG - Intergenic
1201870895 Y:18706406-18706428 TGCTTTGGCCAATGTAGCCCTGG - Intergenic
1201943467 Y:19484102-19484124 TGCCTTGGCAAATGGCACCCTGG + Intergenic