ID: 1024023605

View in Genome Browser
Species Human (GRCh38)
Location 7:45392160-45392182
Sequence TGCTGAGCCAGGCAGTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 540
Summary {0: 1, 1: 0, 2: 11, 3: 69, 4: 459}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024023605_1024023609 10 Left 1024023605 7:45392160-45392182 CCTGGCCACTGCCTGGCTCAGCA 0: 1
1: 0
2: 11
3: 69
4: 459
Right 1024023609 7:45392193-45392215 AAACTGCCAGAGTCACAGATGGG 0: 1
1: 0
2: 1
3: 10
4: 171
1024023605_1024023612 21 Left 1024023605 7:45392160-45392182 CCTGGCCACTGCCTGGCTCAGCA 0: 1
1: 0
2: 11
3: 69
4: 459
Right 1024023612 7:45392204-45392226 GTCACAGATGGGGCCCCCGCTGG No data
1024023605_1024023610 11 Left 1024023605 7:45392160-45392182 CCTGGCCACTGCCTGGCTCAGCA 0: 1
1: 0
2: 11
3: 69
4: 459
Right 1024023610 7:45392194-45392216 AACTGCCAGAGTCACAGATGGGG 0: 1
1: 0
2: 1
3: 16
4: 191
1024023605_1024023613 22 Left 1024023605 7:45392160-45392182 CCTGGCCACTGCCTGGCTCAGCA 0: 1
1: 0
2: 11
3: 69
4: 459
Right 1024023613 7:45392205-45392227 TCACAGATGGGGCCCCCGCTGGG No data
1024023605_1024023614 23 Left 1024023605 7:45392160-45392182 CCTGGCCACTGCCTGGCTCAGCA 0: 1
1: 0
2: 11
3: 69
4: 459
Right 1024023614 7:45392206-45392228 CACAGATGGGGCCCCCGCTGGGG No data
1024023605_1024023616 25 Left 1024023605 7:45392160-45392182 CCTGGCCACTGCCTGGCTCAGCA 0: 1
1: 0
2: 11
3: 69
4: 459
Right 1024023616 7:45392208-45392230 CAGATGGGGCCCCCGCTGGGGGG No data
1024023605_1024023615 24 Left 1024023605 7:45392160-45392182 CCTGGCCACTGCCTGGCTCAGCA 0: 1
1: 0
2: 11
3: 69
4: 459
Right 1024023615 7:45392207-45392229 ACAGATGGGGCCCCCGCTGGGGG No data
1024023605_1024023608 9 Left 1024023605 7:45392160-45392182 CCTGGCCACTGCCTGGCTCAGCA 0: 1
1: 0
2: 11
3: 69
4: 459
Right 1024023608 7:45392192-45392214 GAAACTGCCAGAGTCACAGATGG 0: 1
1: 1
2: 3
3: 34
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024023605 Original CRISPR TGCTGAGCCAGGCAGTGGCC AGG (reversed) Intergenic
900091184 1:921341-921363 TCCTGAGCGAGGCAGGGACCTGG - Intergenic
900186060 1:1333793-1333815 TGCTGGGCCAGGCATCGGGCAGG - Exonic
900310378 1:2030538-2030560 GGCTGAGCCAGGCCGGGGTCTGG + Exonic
900385337 1:2408005-2408027 TGCTGGGCCAGGCAGGGGCGAGG + Intronic
900546899 1:3234417-3234439 TGCTTGGCCTGGAAGTGGCCTGG - Intronic
900746666 1:4365548-4365570 TGGTGACCCGGGCAGTGGACAGG + Intergenic
900888630 1:5432938-5432960 CCCTGAGCCAGGCTGGGGCCTGG - Intergenic
900998007 1:6133304-6133326 GGCTGAGCCAAGGAGTGGGCTGG - Intronic
901033949 1:6325018-6325040 TGCTGGGGCAGGCAGTGCCCAGG - Intronic
901089117 1:6629690-6629712 GGCTGTGCCAGGCAGCGTCCTGG - Intronic
901221734 1:7587262-7587284 TGCTGTGCCTGGCAGAGCCCTGG + Intronic
902082906 1:13833477-13833499 TGCTGAGCCAGTCAGTGGTTGGG + Intergenic
902214059 1:14923842-14923864 TGGGGTGCCAGGCAGAGGCCAGG + Intronic
902286903 1:15412926-15412948 TGATGGGGCAGGCAGGGGCCAGG + Intronic
902758074 1:18562336-18562358 GGCAGAGCCAGGCACTGGCTGGG + Intergenic
903541247 1:24097559-24097581 TCCTGAGCCAGCCGGTGGCAGGG - Intronic
904082667 1:27882067-27882089 TGCTGAGCGAGGTCCTGGCCTGG + Exonic
904173917 1:28611849-28611871 TACTAAGTCAGGCAGTGGCTGGG - Intronic
904684728 1:32251746-32251768 TTCTCAGCAAGGCAGTGGCAGGG + Intronic
905269602 1:36778908-36778930 GGCGGATCCAGGCAGTGGCGGGG - Intergenic
905806529 1:40881412-40881434 TTCCCAGCCAGGCAATGGCCAGG + Intergenic
906180209 1:43811470-43811492 TGAGGAGCAAGGCAGTGGCATGG - Intronic
906647751 1:47488072-47488094 GGGTGAGCCAGGCAGAGGGCTGG + Intergenic
906798284 1:48714654-48714676 TGTTGAGCCAGGAAGCGGCATGG - Intronic
908350989 1:63286317-63286339 TGCTGGGCCAGTCTGGGGCCTGG - Intergenic
908460507 1:64344391-64344413 TGCTTAGCGAGGCCGAGGCCGGG + Intergenic
911596135 1:99800709-99800731 TGCTGAGCCAGGCACAGGAGGGG + Intergenic
911650663 1:100384554-100384576 TGCTGAGCAATGCAGTGACAAGG - Intronic
912438011 1:109675372-109675394 TGGTGATCCTGGCAGTGGCTGGG + Intronic
912440522 1:109693831-109693853 TGGTGATCCTGGCAGTGGCTGGG + Intronic
913020087 1:114780622-114780644 AGCTGAGCCCGGCAGGGGCTGGG - Exonic
913702301 1:121384952-121384974 GGCTGAGCCAGGCAGGGGCCAGG + Intronic
914042864 1:144065447-144065469 GGCTGAGCCAGGCAGGGGCCAGG + Intergenic
914135222 1:144895041-144895063 GGCTGAGCCAGGCAGGGGCCAGG - Intronic
914438446 1:147681011-147681033 TGCTAAGCCAGTCATTGCCCGGG + Intergenic
915296502 1:154925233-154925255 TGCTGAGTCAGAATGTGGCCTGG - Exonic
915681266 1:157584013-157584035 TCCTGATCCAGGCAGTGAACTGG - Intronic
917117480 1:171617022-171617044 AGCTGAGCCATGCTGTGCCCTGG - Intergenic
918197937 1:182240127-182240149 TGTTGAGGCAGGCAATGGCTAGG - Intergenic
919763501 1:201112459-201112481 TGCTGAGCCAGCCAGGGGGCGGG + Exonic
919791313 1:201292609-201292631 TGCTCCCCCAGGCAATGGCCGGG + Intronic
919806089 1:201381811-201381833 TGCTGTGAGAGGCAGGGGCCTGG + Exonic
920489727 1:206403693-206403715 GGCTGAGCCAGGCAGGGGCCAGG + Intronic
920979785 1:210822332-210822354 TGGAGAGGCAGGCAGGGGCCAGG + Intronic
921149352 1:212387171-212387193 TGGTGAGGCAGGCAAGGGCCTGG - Intronic
922235804 1:223721669-223721691 TGCTGAGCTAGGCTGTGGGGTGG - Intronic
922324619 1:224516672-224516694 TGCAGACCCATGCAGGGGCCAGG - Intronic
922786742 1:228286657-228286679 TGCTGAGCCAGGGTGTTGCCTGG + Intronic
923017817 1:230140360-230140382 AGTGGAGCCAGGCAGTGGCAGGG - Intronic
923556825 1:235007637-235007659 TGCTGAGGCAGGCAGTCCCCAGG + Intergenic
1063371995 10:5528083-5528105 TGCTCAGGCAGGCACTGGCTGGG + Intergenic
1063421674 10:5917215-5917237 TGCTGAGACAGGAAGCAGCCGGG - Intronic
1064619965 10:17205314-17205336 TGCTGAGAAAGAGAGTGGCCTGG - Intergenic
1065236463 10:23657574-23657596 ACCTTGGCCAGGCAGTGGCCGGG + Intergenic
1066122058 10:32298838-32298860 TGTTGAGGCAGGCAGTGGGAAGG + Intronic
1067178484 10:43967208-43967230 TGCTGAGCCGGGCACTAGCTGGG - Intergenic
1067263500 10:44715247-44715269 AGCTAATACAGGCAGTGGCCAGG + Intergenic
1067288387 10:44923976-44923998 TGCTGGGAGAGGGAGTGGCCAGG + Intronic
1067801196 10:49360730-49360752 AGCTGAGCCAGGCCAGGGCCAGG + Intergenic
1067999845 10:51319873-51319895 TGGAGAGCCAGGAAGTGGACAGG + Intronic
1069597938 10:69684646-69684668 CTCTGAGCCAGGCACTGTCCTGG - Intergenic
1069851586 10:71408864-71408886 TTCTGAGCCAGGCAGTTGAAAGG - Intronic
1070138943 10:73721871-73721893 TGCTGCACCAGGCAGTGTCTGGG - Intergenic
1070510972 10:77160249-77160271 TGGGGAGCCAGGAAGTGGACTGG - Intronic
1070789063 10:79178924-79178946 CGCTGAGCCAGGCGGGGGCAGGG - Intronic
1070967210 10:80536781-80536803 TGCTCAGCTAGGCAATGTCCAGG - Intergenic
1071709728 10:88038402-88038424 TACTGAAACAGGCAGTGGGCTGG + Intergenic
1072041542 10:91611393-91611415 TGCTGAGCCAAGCTGTGGGAAGG + Intergenic
1072416309 10:95249489-95249511 TACAGATGCAGGCAGTGGCCAGG + Intronic
1072724386 10:97802810-97802832 TACAGAGTCAGGCAGGGGCCAGG + Intergenic
1073266735 10:102232045-102232067 TGCTCAGCGAGGCAGAGGCCCGG - Exonic
1073607477 10:104910908-104910930 CCCTGAGCCAGGCATGGGCCTGG - Intronic
1074056206 10:109924384-109924406 TGCTGAGCAAAGAAGTGACCTGG - Intergenic
1075167885 10:120085559-120085581 AGCTGAGCCTGGCAGAGCCCTGG + Intergenic
1075561702 10:123473049-123473071 AGCTGAGCCCGGCAGAGCCCTGG - Intergenic
1075591110 10:123692368-123692390 AGCTGAGCCAGGCTGAGGCAAGG + Exonic
1075672058 10:124269532-124269554 TCCTGAGCCAGACAGGAGCCCGG + Intergenic
1075672142 10:124270115-124270137 TCCTGAGCCAGACAGGAGCCCGG + Intergenic
1075797876 10:125134336-125134358 TGCTGAGCAAGGCACGGGGCGGG - Intronic
1075923973 10:126235832-126235854 TGCTTACCCAGCCAGTTGCCAGG - Intronic
1075978388 10:126716565-126716587 GGCTCAGCCAGGCAGTGGCGAGG - Intergenic
1075979942 10:126729454-126729476 TCCTGAGCCTGCCAGAGGCCTGG + Intergenic
1076119348 10:127923075-127923097 TCCTGTCCCAGGCAGAGGCCTGG + Intronic
1076737307 10:132464640-132464662 GCCTGAGCCAGGCCCTGGCCAGG + Intergenic
1076784911 10:132745031-132745053 TCCTGAGCCAGCCACTGGCTCGG - Intronic
1076845665 10:133068393-133068415 TGCTGCGCCATGCTGTGGCCAGG - Intergenic
1076907902 10:133372666-133372688 TGCAGAGCCAGGCAGGGGGTGGG + Intronic
1077034712 11:489051-489073 TGCAGAGCCAGGCAGAGCCGGGG - Intronic
1077174258 11:1181497-1181519 AGCTGTGCCAGGCAGTGGGAGGG - Intronic
1077321993 11:1946855-1946877 TGCGGGGCCAGGCTGTGGCCTGG + Intergenic
1077490376 11:2858277-2858299 TCCTGAGCCAGGCGGTGGCCGGG - Intergenic
1077508104 11:2941453-2941475 GGATGAGCCAGGCAGAGGCCAGG + Intergenic
1078325054 11:10373508-10373530 TCTTGGGCCAGGCAGTGGCATGG - Intronic
1078661094 11:13286423-13286445 TACTCAGCCAGTCAGTGGCTGGG - Intronic
1078682026 11:13486290-13486312 AGGTGAGCCAGGCCTTGGCCTGG + Intergenic
1078902305 11:15652843-15652865 TGGTGGCCCAGGAAGTGGCCTGG - Intergenic
1080052417 11:27870917-27870939 TGCTGTGCCAGGCATTGTGCTGG - Intergenic
1080551478 11:33376612-33376634 TGCAGAGCGAGGCAGCGGCCTGG + Intergenic
1080684481 11:34503999-34504021 AGCTGCCCCAGGCAATGGCCTGG - Intronic
1081547175 11:44079673-44079695 GGCTGAGCCAGAAAGTGGCCAGG - Intronic
1081569675 11:44281865-44281887 TGCAGAGACAGACAGTGTCCCGG + Intronic
1081700821 11:45151548-45151570 TGCTGTGCCAGGCACTGTGCTGG + Intronic
1081739953 11:45431868-45431890 TGCTGAACCTGGCAGTGGCCTGG - Intergenic
1081773126 11:45661904-45661926 TGCTGAGGCAGGCACTGGGGCGG + Intronic
1082705625 11:56491205-56491227 TGTGGAGCCAGGCGTTGGCCTGG + Exonic
1082706691 11:56501105-56501127 TGTGGAGCCGGGCATTGGCCTGG + Intergenic
1082775385 11:57240781-57240803 TGCTGAGCCAGACAGGAGCCTGG + Intergenic
1082810020 11:57474131-57474153 TGGTGAGTCAGGCTGAGGCCAGG + Intronic
1083254169 11:61486245-61486267 TGCTCAGCACAGCAGTGGCCTGG + Intronic
1083304300 11:61754670-61754692 GGCTTAGCCATGCAGCGGCCTGG + Intronic
1083778404 11:64905919-64905941 TGAGGTGCCAGGCAGGGGCCAGG - Intronic
1083842286 11:65311342-65311364 TGCTGAGCCTAGAAGTGGCAAGG - Intergenic
1084288575 11:68147288-68147310 GGCTGTGGCAGGCAGTGCCCCGG - Intergenic
1084955257 11:72687875-72687897 GGCTGAGACAGGAAGAGGCCAGG - Intronic
1085300937 11:75457823-75457845 TCCTGGGCCAGGTAGTGGCCTGG - Intronic
1085311753 11:75520973-75520995 TGCTGGCCCAGACAGTGGCCAGG + Intronic
1085523668 11:77152375-77152397 TGCTGTGGCTGGCAGTGGCAAGG + Intronic
1085533871 11:77206708-77206730 TGTTGAGACAGGCAGGGGCTGGG - Intronic
1086307355 11:85496245-85496267 TGCTGAGCCAGGCACAGGAAGGG - Intronic
1086937630 11:92762404-92762426 TGGTGAAACAGGCTGTGGCCTGG - Intronic
1087040241 11:93792066-93792088 TGCTGAGGCAGTCAGCGGGCTGG + Intronic
1089378339 11:118010909-118010931 GGCTGAGCCAGGCACTGGCTGGG - Intergenic
1089462698 11:118662235-118662257 CACTGAGCCAGGCACTGGGCAGG + Intronic
1089500214 11:118927629-118927651 TGCTGTGCCAAGCACTGTCCTGG + Intronic
1089691840 11:120191703-120191725 TTCTGTGCCAGGCACTGTCCTGG + Intergenic
1090406163 11:126476800-126476822 GGCTGGGCCAGGCAGTGGCGAGG + Intronic
1202805009 11_KI270721v1_random:2168-2190 TGCGGGGCCAGGCTGTGGCCTGG + Intergenic
1091409135 12:227746-227768 GGCTGAGCCAGACACTGGCTAGG + Intronic
1092779632 12:11973419-11973441 TACTGAGCCAACCTGTGGCCTGG - Intergenic
1094754667 12:33454279-33454301 TGCTGAGCCAGGGCCTGGCCTGG + Intergenic
1095942255 12:47735010-47735032 GCCTGAGGCAGGCTGTGGCCAGG - Intronic
1097422697 12:59400047-59400069 TGGTGAGGCAGCCAGAGGCCAGG - Intergenic
1098594813 12:72259731-72259753 TGCTGAGCAGGGCAGAGGCCTGG - Intronic
1100558413 12:95721485-95721507 TGTTGAGGCTTGCAGTGGCCTGG - Intronic
1101640001 12:106581058-106581080 TAATGAGCCCGGCAGCGGCCGGG + Intronic
1101923929 12:108955782-108955804 TGCTCTGCCAGGCACTGTCCTGG + Intronic
1102010982 12:109618119-109618141 ACCTGGGCCAGGGAGTGGCCAGG - Intergenic
1102517379 12:113458857-113458879 TCCTCAGCCAGGTAGTGTCCTGG + Intergenic
1102879737 12:116475043-116475065 AGATGAGCTAGGCAGTGCCCTGG + Intergenic
1102944328 12:116972579-116972601 AGCTGAGCGAGGCAGTGGCCTGG + Intronic
1102956505 12:117062593-117062615 GGCGGACCCAGGCAGTGGCATGG + Intronic
1103703567 12:122859959-122859981 TGCTGAGCCCTGATGTGGCCAGG + Intronic
1103746872 12:123130869-123130891 GGCTGAGTCAGGAGGTGGCCAGG + Intronic
1103886767 12:124208320-124208342 TGGGGAGCAAGGCAGTGGCAGGG + Intronic
1104609400 12:130216133-130216155 TGCTGTGACAGGGAGTGGCGGGG + Intergenic
1104860634 12:131921605-131921627 TGCTGAGCCAGGCAGCTGGAGGG - Exonic
1104935879 12:132364194-132364216 GGCTGAGCCGGGCAGTTTCCAGG - Intergenic
1105771864 13:23619784-23619806 GGCTGAGATAGGCAGTGCCCAGG + Intronic
1106239915 13:27903321-27903343 TGCTAATCCAGGCAGCGGCAGGG + Intergenic
1106253325 13:28000777-28000799 TGCTGAGCAATGCTGAGGCCAGG + Intergenic
1106457767 13:29942407-29942429 TGCGGAGCCAGGCACATGCCTGG - Intergenic
1108003269 13:45923856-45923878 GGCAGGGCCAGGCGGTGGCCGGG - Intergenic
1109525073 13:63565530-63565552 TACTGAGCCAGACAGTGTTCAGG + Intergenic
1110046931 13:70842707-70842729 TGCTCAGCTACACAGTGGCCTGG + Intergenic
1111474125 13:88724404-88724426 TGTTGAGCCTGCCAGTGCCCTGG + Intergenic
1111950375 13:94704840-94704862 TGCAGAGAGGGGCAGTGGCCCGG + Intergenic
1114577899 14:23730051-23730073 GGCTGGGCCAGGCAGGGGACAGG - Intergenic
1115188610 14:30721712-30721734 TGCTGAGCCAGGTAGTGAACTGG - Intronic
1116942023 14:50799744-50799766 GGCTGAGCCAGGCAGAGGTCAGG + Intronic
1118683658 14:68269330-68269352 GGCTGAGTCAGGCAGTGCCTTGG - Intronic
1118930377 14:70234891-70234913 CGCTGAGCCAGGCAGTGGAGGGG - Intergenic
1119485675 14:74985025-74985047 CGCTGAGCCAAGCCGTGGGCAGG + Intergenic
1120418782 14:84255447-84255469 AGCAGAGCCAGGAAGAGGCCAGG + Intergenic
1121034012 14:90683971-90683993 TCCCGAGCCAGGCACTGGCCAGG - Intronic
1121313125 14:92945842-92945864 TGCAGCGCCGGGCAGAGGCCTGG - Intronic
1121452468 14:94017867-94017889 AGGTGAGACAGGAAGTGGCCAGG - Intergenic
1121453640 14:94025058-94025080 TGCTGAGCTAAGAAGTGGCCTGG - Intergenic
1122018148 14:98814466-98814488 GGCTGAGCCTGGCACTGACCAGG + Intergenic
1122722918 14:103732171-103732193 TGCTTGGCCTGTCAGTGGCCAGG + Intronic
1122973684 14:105162530-105162552 TGCTGGGCCATGCAGTGCCCTGG - Intronic
1122973774 14:105162830-105162852 TGCTGGGCCATGCAGTGCCCTGG - Intronic
1123450955 15:20358454-20358476 TGGTGGGCCAGGCAGGGGTCCGG + Intergenic
1123992386 15:25693454-25693476 GGCTGAGGCAGGCACTGGCCAGG + Intronic
1124249679 15:28098658-28098680 TGCAGAACCAGGCAGGGGCCAGG - Intronic
1124424788 15:29554726-29554748 CGCTGAGCCAGGGAAGGGCCCGG + Intronic
1124436187 15:29651624-29651646 TGCTGAGCTGGGAAGAGGCCAGG - Intergenic
1124466911 15:29948468-29948490 TGCTGGACCAGGCTCTGGCCTGG - Intronic
1124822880 15:33065052-33065074 TGCTCAGTCAGGCTGTGGTCAGG + Exonic
1124948418 15:34292812-34292834 TGCTGAGCCAGGCATGGGAAGGG + Intronic
1125523614 15:40361876-40361898 GGGTGAGCCAGGCAGAGGCAGGG + Intronic
1125681962 15:41536568-41536590 TCCTCAGGCAGGCAGTGGCCAGG + Exonic
1126792191 15:52231391-52231413 TGGAGAGCCAGGCTGAGGCCAGG - Intronic
1127623388 15:60755952-60755974 TGCTGTGCCAGGCACCGTCCTGG + Intronic
1127863233 15:63011727-63011749 TGCTGAGGGAGGCTGAGGCCAGG + Intergenic
1128983640 15:72203506-72203528 TCCTCTGCCAGGGAGTGGCCTGG - Intronic
1130282869 15:82532835-82532857 TTCTGAGGCAGCCAGAGGCCTGG - Intergenic
1130821707 15:87502954-87502976 GGCTGAGTCAGGGAGAGGCCAGG + Intergenic
1132237942 15:100235908-100235930 ATCTGAACCAGGCAGAGGCCAGG + Intronic
1132677302 16:1126095-1126117 GGCTGGGCCAGCCCGTGGCCAGG + Intergenic
1132867904 16:2102952-2102974 TCCTCAGACAGGTAGTGGCCTGG + Exonic
1132897594 16:2236392-2236414 TCCTGGGCCAGGGAGGGGCCGGG - Exonic
1132954995 16:2586973-2586995 TGCTGAGGGAGGCAGTGACAAGG - Intronic
1133227375 16:4348189-4348211 TACTGCGCCAGCCACTGGCCAGG - Intronic
1133257868 16:4529081-4529103 TGCAGAGCAAGCCAGAGGCCTGG + Intronic
1134050928 16:11136845-11136867 ATCTGAGCCAGGCAGTCCCCCGG + Intronic
1135508050 16:23056127-23056149 TGCTATGCCAAGCACTGGCCTGG - Intergenic
1136238790 16:28931937-28931959 TGCTGGGGCAGGCAGGGGCCTGG - Exonic
1136773266 16:32858785-32858807 TGCTGAGCCAGGAAAGGGTCTGG - Intergenic
1136897349 16:34002734-34002756 TGCTGAGCCAGGAAAGGGTCTGG + Intergenic
1136900756 16:34034891-34034913 TCCTTAGCCCAGCAGTGGCCAGG - Intergenic
1137892215 16:52174619-52174641 TGCACACCCAGGCAGCGGCCTGG - Intergenic
1138269023 16:55681370-55681392 CTCTGAGCCAGGCAGTGTGCCGG - Intronic
1138598566 16:58042092-58042114 TACTGAGGCAGGCAGTGGCTTGG - Intronic
1138650599 16:58458829-58458851 TCCAGAGCCAGGCTGAGGCCGGG + Intergenic
1139478938 16:67217654-67217676 TGCTGTGCCGGGCAGTGTGCTGG - Intronic
1140408074 16:74724267-74724289 TGCGGGGCCCGGCAGAGGCCAGG - Intronic
1142074102 16:88107566-88107588 TGCTGTGCACGGCAGTGGCATGG - Intronic
1142157705 16:88540134-88540156 AGGTGAGCCAGGCAGGGGCAGGG + Intergenic
1142213118 16:88817741-88817763 AGCTCAGCCAGGCAGAGGCCCGG + Intronic
1142355959 16:89602179-89602201 TCCTGACCCAGGTCGTGGCCCGG + Intergenic
1203075688 16_KI270728v1_random:1120895-1120917 TGCTGAGCCAGGAAAGGGTCTGG - Intergenic
1142626978 17:1198419-1198441 TGCAGAATCAGGCAGAGGCCAGG - Intronic
1143001015 17:3795056-3795078 TGCTCAGCCAGCCAGGAGCCAGG + Intronic
1143178267 17:4968733-4968755 TGGTGAGAAAGGCGGTGGCCAGG + Exonic
1143452322 17:7043342-7043364 CGCTGATCCACGCAGTGTCCTGG + Exonic
1144299679 17:13911589-13911611 GGCTGAGCCAGGAAGAAGCCAGG + Intergenic
1146460399 17:33041688-33041710 TGCTGAACCAGGCTGAAGCCAGG + Intronic
1146626125 17:34436878-34436900 TGCTGAGCCAGGAGGTGGCAGGG - Intergenic
1147232563 17:39029893-39029915 TGCTGAGCTTGACAGTGACCTGG - Intergenic
1147361572 17:39934021-39934043 TACTGAGCCAGTCAGAAGCCAGG + Intergenic
1147553525 17:41461963-41461985 TGCTTACCTAGGCTGTGGCCAGG + Intronic
1148108702 17:45132610-45132632 GGCGGGGCCAGGCGGTGGCCTGG + Exonic
1148582176 17:48751877-48751899 TTCTGAGGCAGTCAGTGTCCAGG + Intergenic
1148644997 17:49214786-49214808 CACTGTGCCAGGCACTGGCCAGG - Intronic
1148678400 17:49458512-49458534 TGGTGAAGCTGGCAGTGGCCTGG + Intronic
1148868810 17:50643552-50643574 TGGTGAGTCAGGCAGTGGGCTGG - Intronic
1149311118 17:55395152-55395174 TGCTAAGCTAAGCAATGGCCAGG - Intronic
1149493683 17:57103164-57103186 TGCAGGGCTAGGCAGTGGCCAGG - Intronic
1149695060 17:58610224-58610246 ATCTGGGCCAGGCACTGGCCTGG - Intronic
1150221096 17:63496367-63496389 AGCAGAGCGAGGCCGTGGCCCGG - Intronic
1151109949 17:71664328-71664350 TGGTGGGCCAGGCAGACGCCTGG - Intergenic
1151191694 17:72403004-72403026 GGCTTAGCTAGGCAGTGGCTGGG + Intergenic
1151512587 17:74570389-74570411 TGCAGTGCCAGGCAGGGCCCCGG - Intergenic
1151703279 17:75754318-75754340 TGCTGACCCTGGCAGTGGCGGGG - Intronic
1151764786 17:76127165-76127187 TGCTGAGCCAGGAAGGGGTTTGG - Intergenic
1152036976 17:77879655-77879677 TCCTGTGCCAGGCACAGGCCAGG + Intergenic
1152092591 17:78255398-78255420 CGGTGCGCCAGGCAGTGTCCAGG + Intergenic
1152320812 17:79608166-79608188 TGCTGAGCCACTCAGAGGCAGGG + Intergenic
1152424480 17:80211437-80211459 GGCTCTGCCAGGCAGTGGGCAGG + Intronic
1152540490 17:80972033-80972055 CGGTGAGCCAGGCAGGGGCCAGG - Intergenic
1152656169 17:81520071-81520093 GGCTGGGCCAGGCCGTGGCAGGG + Intronic
1152724714 17:81939536-81939558 GGCTGAGGAAGGAAGTGGCCTGG - Intronic
1153777201 18:8464775-8464797 AGCTGAGCCAGGCAGTTGTTAGG + Intergenic
1155155148 18:23151422-23151444 TGCTGAGACACACAGTAGCCTGG + Intronic
1155184531 18:23375641-23375663 TACTGAGCAAGGCAGTGGGTGGG + Intronic
1155862851 18:30925902-30925924 TACTGAGCCATTCAGTGTCCTGG + Intergenic
1155919900 18:31593190-31593212 TGCTTAGCTAGGAAGTGACCAGG + Intronic
1156352295 18:36311757-36311779 GGTTGAGGCAGGCAGGGGCCAGG - Intronic
1156534650 18:37850783-37850805 AGGCAAGCCAGGCAGTGGCCAGG - Intergenic
1156696779 18:39776962-39776984 TGCTTAGTCAAGCAGTGGTCAGG - Intergenic
1157562529 18:48658960-48658982 TGGTGGCCCAGGCAGTGCCCAGG - Intronic
1157732199 18:50013885-50013907 TGCTGGGCTAGGCAGTGGAGGGG - Intronic
1158665323 18:59427633-59427655 TGCAGAGGCAGGCAGGGGCGAGG - Intergenic
1160181159 18:76637987-76638009 TGCGGAGCCAGACAGGTGCCTGG + Intergenic
1160667989 19:342210-342232 GGCTCAGCAAGGCAGTGGCGTGG + Intronic
1160952618 19:1674874-1674896 CGCTGGGCCAGGCAGTGGTCAGG + Intergenic
1161026725 19:2040386-2040408 GGCTGGGCCAGGCTGAGGCCTGG + Intronic
1161979385 19:7622663-7622685 TGCAGGGGCAGACAGTGGCCGGG + Intronic
1162301514 19:9847607-9847629 GGCTGACCCAGGCAGGGGGCTGG - Intronic
1163144269 19:15370056-15370078 TTCTGAGCAAGCCAGGGGCCTGG - Intronic
1163725524 19:18921284-18921306 TCATGAGCCAGGGAGAGGCCAGG + Intronic
1163820960 19:19496344-19496366 TTCAGAGCCAGGCAGGGGCTTGG + Intronic
1164668940 19:30062323-30062345 TGATGCGCCAGGCAATGGACTGG - Intergenic
1164768934 19:30793044-30793066 GGCTGAGGCAGGGAGTGGCCTGG + Intergenic
1165107120 19:33477079-33477101 TGGAGAGACAGGCAGTGGCTGGG - Intronic
1165243969 19:34487395-34487417 TTCAGAACCAGGCAGGGGCCAGG - Intronic
1165423640 19:35733899-35733921 AGCTGAGCCAGGCACAGGCAAGG - Intronic
1166194649 19:41197875-41197897 AGCTGATCCAGGCGGAGGCCCGG + Exonic
1166254198 19:41590618-41590640 TCCTGTGCCAGGCTGTGGGCTGG - Intronic
1167491692 19:49796208-49796230 TAGTGAGCCAGGCACTGGGCAGG + Intronic
1167567666 19:50267098-50267120 GGCTGAGCCAGCCTGTGCCCAGG + Intronic
1167706595 19:51084654-51084676 GGCTGAGTCAGGCTGAGGCCGGG - Intergenic
1168305520 19:55433193-55433215 TGCTGGGGCAGGTGGTGGCCCGG + Exonic
1168348301 19:55661332-55661354 AGTTGAGCCAGCCAGGGGCCGGG + Intronic
1168670606 19:58238435-58238457 GGCTGAGCCAGGCATGGGGCAGG + Intronic
925052258 2:825228-825250 TGCTGCTCCCTGCAGTGGCCAGG - Intergenic
926200139 2:10789237-10789259 GGCAGAGCCAGGCTGTGTCCAGG - Intronic
927187484 2:20492213-20492235 GGCTGGGCCTGGCCGTGGCCAGG + Intergenic
927935316 2:27072607-27072629 CACTGAGCCAGGCCGGGGCCGGG + Intergenic
928169395 2:28993711-28993733 TGCTGGGCCGGGCACTGGGCTGG + Intronic
929026958 2:37614150-37614172 TGCTGGGCCAGGCTGTGGATGGG + Intergenic
929962818 2:46509177-46509199 TGATGAGCCAGGCACTGTGCTGG - Intronic
932725781 2:74178705-74178727 TCCTGATCCAGGCGGGGGCCAGG - Exonic
933788666 2:85865773-85865795 TGCTGAGCCAGACAGTGCTCTGG + Intronic
934489767 2:94754206-94754228 TGCTGAGCTAGCCAGTCTCCTGG - Intergenic
934759803 2:96848229-96848251 TGCTGACCAAGGCAGGGGCTTGG + Exonic
934913655 2:98280608-98280630 TCCTGAGCCCGGCACAGGCCTGG - Intronic
935661578 2:105471215-105471237 CACTGAGCCAGGCAGGGTCCAGG - Intergenic
936016603 2:108963985-108964007 AGCTGAGCCTGGCACTGTCCAGG + Intronic
937991997 2:127668862-127668884 GGCTGAGGCAGGCAGAGCCCAGG + Intronic
940689687 2:156900041-156900063 TGCTGAGCCAATTAGTGGGCTGG - Intergenic
944124156 2:196274559-196274581 TGCTGAGCCAGGGAATTCCCTGG - Intronic
944140429 2:196450292-196450314 TGCTTAGCCAGAGAGTGGCAGGG + Intronic
944413861 2:199464652-199464674 TGGCGAGCCAGGCAGCGGGCCGG + Intronic
945161878 2:206900029-206900051 TGCTGAGCCAGGCATGGGAGGGG + Intergenic
948219692 2:236259798-236259820 TGCTGAGGCAGGCATTAGGCAGG - Intronic
948650602 2:239441096-239441118 TCGTGAGCCAGGCAGTGACTTGG + Intergenic
948729971 2:239956644-239956666 GGCTGTGACAGGCAGTGGGCTGG - Intronic
948777016 2:240294440-240294462 TGCACAGCCAGGCACAGGCCTGG + Intergenic
948871242 2:240799316-240799338 TGGGGAGCCTGGGAGTGGCCTGG - Intronic
1169000309 20:2163541-2163563 GGGTGAGCCAGGCGGTGGCTGGG + Intronic
1170855662 20:20052024-20052046 TACTGAGCCAGGCACTGCACTGG - Intronic
1171107696 20:22450626-22450648 TGCTGTGCCAGACACTGGTCTGG - Intergenic
1172266833 20:33623175-33623197 TGCTGAGCCAGGTACTGGGATGG - Exonic
1172278384 20:33693834-33693856 CCCTCAGCCAGCCAGTGGCCTGG - Intergenic
1172834333 20:37863447-37863469 TGCTGAGGGAGGGAGTGGCACGG + Intronic
1173006397 20:39142767-39142789 TGCTGAGCCTGGCAGGGGATGGG + Intergenic
1173136328 20:40442445-40442467 TGCTGAGCCACTCTGTGGCTGGG - Intergenic
1173221371 20:41135740-41135762 TGTTGAGCCAGGCAGTGGGTCGG - Intergenic
1174266093 20:49333268-49333290 TCATGAGCCAGGCACTGTCCTGG - Intergenic
1175116508 20:56686213-56686235 TGCTGAGCCAGGCGGGGTTCTGG + Intergenic
1175576405 20:60063920-60063942 TCCTGTGCCAGGATGTGGCCTGG + Intronic
1175698153 20:61117861-61117883 TGCTGAGTCATGCAGGGGCCTGG - Intergenic
1175744406 20:61445270-61445292 TGGAGAGCCAGGCAGGGCCCCGG + Intronic
1175908458 20:62393237-62393259 GCCTGAGCCAGGCAGTGGGGAGG - Intronic
1175968702 20:62673144-62673166 TGCTGGGCCAGGGAGGGGCATGG + Intronic
1176139651 20:63539382-63539404 TCCTGAGCCAGGCTTTGGCCGGG + Intergenic
1176673236 21:9753260-9753282 CCCTGAGCCAGGCAGAGTCCGGG + Intergenic
1178768671 21:35481418-35481440 AGCTGAGTCAGGTAGTGGCTGGG - Intronic
1179229008 21:39483714-39483736 TGCTGGGCCAGACACTGGGCTGG + Intronic
1179257372 21:39728420-39728442 ACCTGAGCCAGGAAGAGGCCAGG + Intergenic
1179275546 21:39888765-39888787 TGCTGAGCCAGGTCCTGGGCTGG - Intronic
1179564397 21:42237577-42237599 CTCTGAGCCAGGCACTGGCTGGG - Intronic
1179801476 21:43813368-43813390 TGGGGAGCCAGGCAGGGGCAGGG + Intergenic
1179910387 21:44444355-44444377 TGCTGAGCCTGTCTGTGCCCTGG + Intergenic
1180066647 21:45415767-45415789 TGCAGCGCCAGGCACTGGGCTGG - Intronic
1180070213 21:45432159-45432181 TGCTGGGGCAGGGAGAGGCCTGG - Intronic
1180076767 21:45467118-45467140 TGCCGTGCCAGGCAGAGCCCGGG - Intronic
1180859032 22:19066592-19066614 CACTGAGGCAGGCAGAGGCCAGG + Intronic
1180875544 22:19173566-19173588 TGGAGAGGCAGGCAGGGGCCTGG - Intergenic
1181013310 22:20054636-20054658 TGAGGATACAGGCAGTGGCCAGG + Intronic
1181165404 22:20980436-20980458 TGCTGAGCCTGGCAGAAGCTAGG + Intronic
1181326970 22:22057398-22057420 TGCTGAGCCAGGCAACGGGAGGG + Intergenic
1181556812 22:23675939-23675961 TGCTGAGCCAGGCACTGGACTGG - Intergenic
1181697573 22:24601645-24601667 TGCTGAGCCAGGCACTGGACTGG + Intronic
1181764986 22:25085032-25085054 TGCTGGGCCATGCAGTGACAAGG + Intronic
1182447442 22:30397816-30397838 TCCTGAACCAGGCAGGGGTCTGG - Intronic
1183082882 22:35468080-35468102 TGCAGAGCCAGGCATGGCCCTGG + Intergenic
1183226543 22:36554046-36554068 TGATGAGCCAGGCAGAAGCAGGG - Intergenic
1183284296 22:36952736-36952758 TGCTCAGCCAGGCACCTGCCAGG - Intergenic
1183480879 22:38064914-38064936 GACAGAGCCAGGCAGTGGTCAGG + Intronic
1183831547 22:40420779-40420801 CCCTGAGCCAGGCAGGTGCCAGG - Intronic
1184049729 22:41995460-41995482 AGCAGAGACAGGCAGTGGCCTGG - Intronic
1184254631 22:43280121-43280143 TGCTGAGCAAGGCGCTGGGCAGG + Intronic
1184343846 22:43900981-43901003 TGCCAAGCCTGGCATTGGCCAGG + Intergenic
1185023621 22:48395094-48395116 TGAGGAGACAGGCAGGGGCCAGG + Intergenic
1185047751 22:48537488-48537510 TGCTGAGTCAGTAAGTGGCAGGG - Intronic
1185137453 22:49080840-49080862 ACCTGAGCCAGGCAGTGTCCGGG - Intergenic
1185275332 22:49948160-49948182 AGCTGAGCCACCCAGGGGCCTGG + Intergenic
1185347122 22:50315276-50315298 TGCTGGGCCCGGCAGGAGCCAGG - Intronic
949189373 3:1233319-1233341 TGGTGAGCTAGGCAGGGGTCTGG + Intronic
949491108 3:4589881-4589903 TCCAGAGGCAGGCAGGGGCCTGG - Intronic
949919631 3:8990715-8990737 TGCTGGGGCAGGCAGCAGCCCGG + Exonic
950476844 3:13220169-13220191 TCCTGGGGCCGGCAGTGGCCGGG + Intergenic
952218086 3:31297398-31297420 TGCTTAACCAGGAGGTGGCCAGG + Intergenic
952311515 3:32194747-32194769 TGCTGAGCCAGGCTGTGTCATGG - Intergenic
952840557 3:37641776-37641798 GCCTGAGGCAGGCAGAGGCCTGG - Intronic
953316644 3:41933655-41933677 AGCTGTACAAGGCAGTGGCCAGG - Intronic
954038285 3:47865321-47865343 TGCTGAGCCTGGCTTTGTCCTGG - Intronic
954194832 3:48990335-48990357 GCCTGAGCCTGGCAGTGGTCTGG - Exonic
954626207 3:52023366-52023388 TGCTGAGCCAGGCCCTGGCCAGG + Intergenic
954661087 3:52227269-52227291 TGCTGAGCCAGCCAGATGCCTGG - Intergenic
954690038 3:52390909-52390931 TGGAGAGCCAGGCACTGGACTGG - Intronic
954709598 3:52498824-52498846 TGCTGAGCCAGGGAGAGACTAGG - Intronic
956951828 3:74292267-74292289 TGATGAGCCAGAAACTGGCCAGG + Intronic
960447085 3:117762265-117762287 TGCTGAGTCAGGGGGTGGCAGGG + Intergenic
961387524 3:126530805-126530827 TGCTGGGCTGGTCAGTGGCCTGG + Intronic
961570335 3:127793191-127793213 TGCTGAGCCAGCCAAGGGCCAGG - Intronic
961588096 3:127951415-127951437 TGCTGAGGCAGGAAGGGGTCAGG + Intronic
961644675 3:128386465-128386487 AGCTGAGACAGGCAGTGGGGGGG + Intronic
962178811 3:133183703-133183725 TGTTGAGGCAGGGAGTGGGCAGG + Intronic
962709163 3:138071221-138071243 TGGGGAGGCAGGCAGAGGCCCGG - Intronic
963047205 3:141111527-141111549 TGTTGAGGCAGGAAGAGGCCTGG + Intronic
963298392 3:143572879-143572901 AACTGAACCAGGCAGTTGCCTGG + Intronic
965600423 3:170448646-170448668 TGCTGGGCCAAGCTGTGGCTGGG + Intronic
966942766 3:184757453-184757475 TGCTGAGCCAGACAGGGGGCAGG - Intergenic
967171822 3:186827685-186827707 TGCCCAGCCTGGCAGTGGACCGG + Intergenic
968601936 4:1513579-1513601 TGCTGACCCCGGCAGGGCCCGGG + Intergenic
968909995 4:3472811-3472833 TGCTGTGCTGGGCAGTGGCCGGG + Intronic
969345128 4:6565093-6565115 CGCTGTGCCAGGCAGAGGGCTGG - Intergenic
969725331 4:8915103-8915125 CACAGAGCCAGGAAGTGGCCGGG - Intergenic
971685632 4:29762923-29762945 TGCTAAGCCTGGCAGTGAACAGG - Intergenic
972852540 4:43068908-43068930 AGCTGAGGCAGGCAGAGGTCAGG + Intergenic
973312944 4:48729066-48729088 TGCTGAGCCAGGCACGGGAGGGG - Intronic
974580299 4:63790779-63790801 TGCTGAGGCAGGCAGTACCTGGG + Intergenic
976218846 4:82739992-82740014 TGCTGAGACATGAAGTGGCTGGG - Intronic
977722613 4:100257737-100257759 TGCTGAGTCAGGGAGGGGCCTGG - Intergenic
978595674 4:110374540-110374562 TGCTGTGCCAAGCAGGGGCCAGG + Intronic
979442983 4:120774496-120774518 TACTGAACCAGGCTGTAGCCTGG + Intronic
979476004 4:121157925-121157947 TGCTGCACCAGGCAATGGTCAGG - Intronic
980803553 4:137783980-137784002 TGCTGAGCCAGGCACGGGAGGGG - Intergenic
981918691 4:150062910-150062932 TGCTGTGCCAGGCACTGAGCTGG - Intergenic
982306991 4:153943235-153943257 TGCTGAAGGAGGCAGAGGCCAGG + Intergenic
985401471 4:189598423-189598445 CCCTGAGCCAGGCAGAGTCCGGG - Intergenic
985659787 5:1151398-1151420 TGCTGGGGCTGGCAGAGGCCGGG - Intergenic
985818088 5:2141641-2141663 TGCTGAGCCCGGCTGTGGCGTGG + Intergenic
985909327 5:2866548-2866570 TCCAGTGCCAGGCATTGGCCAGG + Intergenic
986022217 5:3814994-3815016 TGATGAGCCAGGCATAGGCTAGG + Intergenic
986806074 5:11310168-11310190 TCCTGGGCTAGGCAGTGGCTAGG + Intronic
987444976 5:18006334-18006356 TGCTGAGCCAGGCACGGGAGGGG - Intergenic
988557441 5:32249939-32249961 TGCTGACCAAGCCATTGGCCTGG + Intronic
989797156 5:45489699-45489721 TGATGAGCCAGGCATTGTCTAGG + Intronic
992756467 5:79911314-79911336 TGCTGAGCCAGGCACGGGAAGGG - Intergenic
992944474 5:81796167-81796189 TGTTGAATCAGGCAGTGGTCTGG - Intergenic
995446878 5:112254600-112254622 GGCTGAACCAGGCAGTGTGCTGG + Intronic
997349749 5:133222154-133222176 TGCTGAGACAGGCTCTGGGCAGG + Intronic
997653488 5:135538761-135538783 TGCTGGGCCAGGCACTGTGCTGG + Intergenic
998162867 5:139823212-139823234 TGCTGAGACAGCCTGGGGCCTGG - Intronic
998228280 5:140343374-140343396 TCCTGAGCCAGGCTCTGCCCTGG - Intronic
999126509 5:149250142-149250164 TCCAGAGCCAGCCTGTGGCCAGG + Intronic
999232343 5:150069195-150069217 CCCTGAGCCAGGCAGATGCCAGG + Intronic
999439216 5:151588606-151588628 TTCTGTGCCAGGCACTGTCCTGG + Intergenic
1001315027 5:170635914-170635936 GGCAGTGGCAGGCAGTGGCCAGG + Intronic
1001940724 5:175737651-175737673 GGCTTGGCCAGGCAGTGCCCAGG - Intergenic
1002026474 5:176399230-176399252 TGCTGGGCCAGGCACTGTGCTGG - Intronic
1002573242 5:180155922-180155944 TGCTGAGCAAGCAAGTGACCAGG + Intronic
1002764750 6:229281-229303 GGCTCAGCCAGGCAGTGGGTGGG + Intergenic
1003063127 6:2877621-2877643 TGCTGAGTCATGCAGGGGTCAGG - Intergenic
1003259058 6:4500132-4500154 TGCTGTGCCAGGCAGTGTGCTGG - Intergenic
1003596822 6:7481536-7481558 TGCTGAGGTGGGTAGTGGCCCGG + Intergenic
1003654991 6:7998770-7998792 CGTTCGGCCAGGCAGTGGCCAGG + Intronic
1005047333 6:21654574-21654596 TGCTGATGTAGGCAATGGCCGGG + Intergenic
1005957273 6:30672895-30672917 TGCTGGGCCGGTCAGAGGCCTGG + Exonic
1006514725 6:34539494-34539516 TGGTGAGCCAGGCAGCGGCAGGG - Exonic
1006602645 6:35236156-35236178 TGCTGTGCCAGGCACTTGCCAGG - Intronic
1006838801 6:37015113-37015135 TGCAGTGCCAGGTAGAGGCCAGG - Intronic
1007346876 6:41237359-41237381 TGCTGAGCTGGGCATTGACCCGG - Exonic
1007356230 6:41319674-41319696 TGCTGAGACGGTCAGTGGGCAGG - Intergenic
1008317125 6:50058413-50058435 GGCACAGCCAGGCAGTGACCAGG + Intergenic
1008677935 6:53841218-53841240 TGCAGAGCCAGGCAGGAGCCTGG - Intronic
1010857785 6:80863221-80863243 TGCAGAGCCAGGCTGGGCCCAGG + Intergenic
1011217466 6:85020083-85020105 TGATGAGCCAGCAAGAGGCCTGG + Intergenic
1012404249 6:98876830-98876852 GGCAGAGTCACGCAGTGGCCAGG + Intronic
1013055935 6:106582898-106582920 ATCTGAGACAGTCAGTGGCCAGG - Intronic
1013356190 6:109347885-109347907 TCCCCAGCCAGGCAGTGCCCAGG - Intergenic
1014013287 6:116501190-116501212 TGCTGAGCCAGTCACAGGCTCGG - Intronic
1017919867 6:158862222-158862244 TGCTAAGCAGGGCAGTGGCCTGG - Intergenic
1017985165 6:159437107-159437129 TGGGGAGCCGGGCAGTGGCAGGG + Intergenic
1018013554 6:159693144-159693166 TGTTGAGCCGGGCAGTGTGCGGG - Exonic
1018768191 6:166950650-166950672 TGCAGATCCAGGCAGTGTCCTGG + Intronic
1019047869 6:169162065-169162087 CGCAGAGCCAGTCCGTGGCCTGG + Intergenic
1019430812 7:998181-998203 TGCTCAGGGCGGCAGTGGCCAGG + Intronic
1019472140 7:1226849-1226871 TGGCGGGACAGGCAGTGGCCAGG - Intergenic
1019780304 7:2935864-2935886 TGCCCAGCAAGGAAGTGGCCAGG + Intronic
1022074101 7:26949008-26949030 TGCTAAGCAAGACAATGGCCAGG - Intronic
1022248851 7:28586887-28586909 TTCTGAGCCAGGCATTTGCCAGG - Intronic
1022449694 7:30503557-30503579 TACAGAGGCAGGCAGTGTCCAGG + Intronic
1022474821 7:30702841-30702863 TGTGGAACCAGGCAGAGGCCGGG + Intronic
1022923173 7:35036891-35036913 AGCTGAGCCAGGGAGTTGCGGGG + Intronic
1023837242 7:44075492-44075514 AGCTGAACTGGGCAGTGGCCCGG + Intronic
1023889260 7:44380996-44381018 TGCTGACTCAGGCATTGGGCTGG - Exonic
1024023605 7:45392160-45392182 TGCTGAGCCAGGCAGTGGCCAGG - Intergenic
1024252899 7:47519755-47519777 GGCTGAGTCATGCAGAGGCCAGG + Intronic
1024559426 7:50630815-50630837 TGCCAAGCCAGCCAGAGGCCTGG - Intronic
1026633822 7:72063500-72063522 TGCTGAGCTAGATAGAGGCCTGG + Intronic
1026904131 7:74053185-74053207 TGGTGGGCCAGGCTTTGGCCCGG + Exonic
1027184978 7:75965666-75965688 CCCTGAGCCAGGGGGTGGCCAGG - Intronic
1027357521 7:77372822-77372844 TGGAGAGGCAGGCAGGGGCCAGG - Intronic
1028496208 7:91463634-91463656 GGCTGAGCCAGGCACAGGCAGGG + Intergenic
1029109552 7:98205675-98205697 TGCAGAGCGAGGCCGTGTCCAGG + Exonic
1029170119 7:98624607-98624629 TGCTAAGACGGGGAGTGGCCGGG - Intronic
1029276374 7:99407587-99407609 TTCTGTGCCAGGAGGTGGCCAGG + Intronic
1029437743 7:100572469-100572491 CGCTGAGCCAGGCAGTGGAGGGG + Exonic
1029473981 7:100771986-100772008 TGTTCCGCCAGGCAGGGGCCTGG - Exonic
1029612916 7:101636870-101636892 GGCTCAGGCAGGCAGTGCCCAGG + Intergenic
1029698076 7:102227688-102227710 TGCTGAGTCAGGAGGTGGCAGGG + Intronic
1030935980 7:115585290-115585312 TGCTGAGTCATGCAGTTGTCAGG - Intergenic
1030983341 7:116211102-116211124 TCCTGAGCCAGGAAGTGTCACGG - Intronic
1031397268 7:121288327-121288349 TGTTGGGCCAGCCACTGGCCTGG + Intronic
1032192657 7:129773507-129773529 GTCTGAGCCAGGGAGTGCCCGGG - Intergenic
1032456228 7:132075378-132075400 TGGGGAGCCTGACAGTGGCCCGG - Intergenic
1032753485 7:134865710-134865732 TGCAGAGCCGGGCAGTGTCTTGG - Intronic
1033669714 7:143479265-143479287 AGTTGTGGCAGGCAGTGGCCTGG + Intergenic
1034396046 7:150825658-150825680 TGCTAAGCCAGGCTGTGATCTGG - Intronic
1035310239 7:157963159-157963181 GGCTGAGCCGGGCAGTCTCCTGG + Intronic
1035345192 7:158192844-158192866 GGCTGAGGCAGCCAGAGGCCGGG + Intronic
1035410183 7:158633663-158633685 TGCTGAGCCAGGCAGTTGCTGGG - Intronic
1035689510 8:1550569-1550591 TGCTTAGAGAGGCTGTGGCCAGG - Intronic
1037743539 8:21626028-21626050 TGCGGTCTCAGGCAGTGGCCAGG + Intergenic
1038490991 8:27971081-27971103 CTATGTGCCAGGCAGTGGCCTGG - Intronic
1038696632 8:29812325-29812347 TGATGCCCCAGGCAGTGGGCAGG - Intergenic
1039562477 8:38523809-38523831 TGCTGAGCTAGCCAGTCTCCTGG + Intronic
1039584094 8:38691124-38691146 TACTGAGCCAGGGAGGGCCCGGG - Intergenic
1041653833 8:60328840-60328862 TGCTGAGCAATGCAGCTGCCAGG + Intergenic
1043488330 8:80720905-80720927 GCCTGGGCCAGGCAGGGGCCAGG + Intronic
1044942398 8:97356614-97356636 TGCAGAGCCAGACACTGGCGGGG + Intergenic
1045529737 8:102973126-102973148 TGCGGAGCCAGGCATCTGCCTGG - Intronic
1047207845 8:122817828-122817850 TGGTGACCCTGGCAATGGCCTGG + Intronic
1048199644 8:132360964-132360986 TGAAGAGCCAAGCAGTAGCCTGG - Intronic
1048203440 8:132396141-132396163 TTCCGACCCAGGCAGTGGCCTGG + Intronic
1048872644 8:138812093-138812115 TGCTGAGCCAGCCAGTGAAATGG - Intronic
1049207961 8:141372128-141372150 TGCTGGTCCAGGCACAGGCCAGG - Intergenic
1049361913 8:142215988-142216010 TGCTGAGGCAGGCAGAGGCTGGG - Intronic
1049593685 8:143473848-143473870 TGCTGTGCCAGAGACTGGCCAGG + Intronic
1049602814 8:143515765-143515787 AGCTGGGCCAGGCAGGGGCTGGG + Intronic
1049741604 8:144243615-144243637 TGGTGAGCGTGGCCGTGGCCTGG + Exonic
1049743410 8:144251896-144251918 TGCTGTGCTAAGCAGAGGCCGGG - Intronic
1049882415 8:145075398-145075420 TGCTGAGCCTGATCGTGGCCAGG - Intergenic
1050334215 9:4574995-4575017 TGCTGAAACAGGCAGTGCCAGGG + Intronic
1051737865 9:20220462-20220484 TTCTGATCCAGGAAGTGGTCAGG - Intergenic
1057391206 9:94642789-94642811 TGCACAGCCAGTAAGTGGCCAGG - Intergenic
1057435686 9:95038498-95038520 TACTTAGCCAGGTAGTGGCCTGG - Intronic
1057718772 9:97516218-97516240 CTCTGAGCCAGGCAGGGGCTGGG + Intronic
1058130866 9:101251537-101251559 TTTTGAGCAAGGCAGTGGCATGG - Intronic
1058723926 9:107784359-107784381 GGCTGAACCAGGCAGTGGGGTGG + Intergenic
1059209008 9:112494018-112494040 TACAGAACCAGGCAGTGGGCTGG + Intronic
1059801721 9:117756453-117756475 GGCTGAACCAGGCATTGGGCAGG - Intergenic
1060115061 9:120933833-120933855 TGCTGTACTAGCCAGTGGCCAGG - Intergenic
1060194324 9:121613465-121613487 TGCTAGGGCAGGAAGTGGCCCGG + Intronic
1060223150 9:121774871-121774893 TGAAGAGCCAGGCCGTGGGCAGG - Intronic
1061164346 9:128913695-128913717 TGCTGACACATGCAGTGGTCAGG - Intronic
1061181548 9:129027810-129027832 TCCTCAGCCAGGCAGGCGCCAGG + Intronic
1061218620 9:129236226-129236248 GGCAGAGCCAGGCTGTGTCCTGG + Intergenic
1061368081 9:130182832-130182854 GGCTGAGCCAGGCACAGGGCAGG - Intronic
1061542325 9:131284034-131284056 TGCTGGTTCATGCAGTGGCCTGG + Intergenic
1061566438 9:131443895-131443917 TGCTGGGGCAGGCTGTGGCCTGG + Intronic
1061881115 9:133569546-133569568 TCCTGGGCCAGCCAGTGGGCGGG - Exonic
1061949573 9:133928912-133928934 TGATGACCCTGGCAGTGGGCAGG - Intronic
1062084130 9:134640084-134640106 TGCTGACACAGGCCATGGCCTGG - Intergenic
1062116948 9:134814663-134814685 TGCTGAGCCCTGCAGGGGGCTGG - Intronic
1062139150 9:134945834-134945856 CCCTGAGCCAGGCCCTGGCCCGG + Intergenic
1062165516 9:135105527-135105549 CGCTGAGCATGGGAGTGGCCAGG + Intronic
1062181668 9:135194288-135194310 TGGTCAGCCAGGCAGTGGCTGGG - Intergenic
1062268011 9:135696191-135696213 TGCAGACCCAGGGAGTGACCAGG + Intronic
1062339873 9:136089243-136089265 ATCTGAGCCAGGCTCTGGCCAGG + Intronic
1062430279 9:136523795-136523817 TGGTGAGGCAGGCATTGTCCAGG + Exonic
1062482406 9:136758605-136758627 TGCACAGCCAGGAAGAGGCCAGG - Intergenic
1185603835 X:1355670-1355692 TGAGAAGCCAGGCAGGGGCCAGG + Intronic
1189099625 X:38175278-38175300 TGATGAGCCAGGCAGTTGCAGGG - Intronic
1189287038 X:39858930-39858952 TGCTGGGCCAGGCATTGAACTGG - Intergenic
1189294771 X:39910486-39910508 TGCAGAGCCAAGCTGTGGCAGGG - Intergenic
1192724097 X:73729353-73729375 TTCTCTGCCAGCCAGTGGCCAGG + Intergenic
1195778069 X:108429966-108429988 TGCTCAGCCTGGCAGTATCCTGG + Intronic
1196579666 X:117363901-117363923 AGCTGAGTCAGGGAGTGCCCAGG - Intergenic
1196588272 X:117456004-117456026 TGGAGAGGCAGGCAGAGGCCAGG + Intergenic
1197331356 X:125156951-125156973 TTATGTGCCAGGCACTGGCCTGG + Intergenic
1197835552 X:130690274-130690296 TCCAGAGCCAAGCACTGGCCAGG - Intronic
1200059039 X:153475942-153475964 AGCTGAGCCCGCCAGGGGCCAGG - Intronic
1200154329 X:153967333-153967355 TCCTGAGCAAGGCTGTGCCCCGG + Intronic
1200648796 Y:5816363-5816385 TCCTGAGCCATGCTGAGGCCCGG + Intergenic