ID: 1024023606

View in Genome Browser
Species Human (GRCh38)
Location 7:45392165-45392187
Sequence GCAGCTGCTGAGCCAGGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 955
Summary {0: 1, 1: 1, 2: 11, 3: 161, 4: 781}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024023606_1024023608 4 Left 1024023606 7:45392165-45392187 CCACTGCCTGGCTCAGCAGCTGC 0: 1
1: 1
2: 11
3: 161
4: 781
Right 1024023608 7:45392192-45392214 GAAACTGCCAGAGTCACAGATGG 0: 1
1: 1
2: 3
3: 34
4: 262
1024023606_1024023613 17 Left 1024023606 7:45392165-45392187 CCACTGCCTGGCTCAGCAGCTGC 0: 1
1: 1
2: 11
3: 161
4: 781
Right 1024023613 7:45392205-45392227 TCACAGATGGGGCCCCCGCTGGG No data
1024023606_1024023615 19 Left 1024023606 7:45392165-45392187 CCACTGCCTGGCTCAGCAGCTGC 0: 1
1: 1
2: 11
3: 161
4: 781
Right 1024023615 7:45392207-45392229 ACAGATGGGGCCCCCGCTGGGGG No data
1024023606_1024023610 6 Left 1024023606 7:45392165-45392187 CCACTGCCTGGCTCAGCAGCTGC 0: 1
1: 1
2: 11
3: 161
4: 781
Right 1024023610 7:45392194-45392216 AACTGCCAGAGTCACAGATGGGG 0: 1
1: 0
2: 1
3: 16
4: 191
1024023606_1024023616 20 Left 1024023606 7:45392165-45392187 CCACTGCCTGGCTCAGCAGCTGC 0: 1
1: 1
2: 11
3: 161
4: 781
Right 1024023616 7:45392208-45392230 CAGATGGGGCCCCCGCTGGGGGG No data
1024023606_1024023609 5 Left 1024023606 7:45392165-45392187 CCACTGCCTGGCTCAGCAGCTGC 0: 1
1: 1
2: 11
3: 161
4: 781
Right 1024023609 7:45392193-45392215 AAACTGCCAGAGTCACAGATGGG 0: 1
1: 0
2: 1
3: 10
4: 171
1024023606_1024023612 16 Left 1024023606 7:45392165-45392187 CCACTGCCTGGCTCAGCAGCTGC 0: 1
1: 1
2: 11
3: 161
4: 781
Right 1024023612 7:45392204-45392226 GTCACAGATGGGGCCCCCGCTGG No data
1024023606_1024023614 18 Left 1024023606 7:45392165-45392187 CCACTGCCTGGCTCAGCAGCTGC 0: 1
1: 1
2: 11
3: 161
4: 781
Right 1024023614 7:45392206-45392228 CACAGATGGGGCCCCCGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024023606 Original CRISPR GCAGCTGCTGAGCCAGGCAG TGG (reversed) Intergenic
900031129 1:373873-373895 ACAGCTGCAGAGGGAGGCAGGGG - Intergenic
900051696 1:602122-602144 ACAGCTGCAGAGGGAGGCAGGGG - Intergenic
900319197 1:2074218-2074240 GGACCTTCTGAGCGAGGCAGGGG + Intronic
900774723 1:4573941-4573963 GCAGCTCCTGGGGCAGACAGTGG - Intergenic
901039694 1:6356457-6356479 GCAGGTGCTGAGCTGGGCTGAGG - Intronic
901087770 1:6622139-6622161 GCAGCAGCTGAGGCAGGCAGAGG - Exonic
901510821 1:9717300-9717322 GCAGCCGGTGAGCCAGGCATGGG - Intronic
902082903 1:13833472-13833494 GCACCTGCTGAGCCAGTCAGTGG + Intergenic
902096462 1:13950029-13950051 GGGGCTGCAGAGCAAGGCAGGGG - Intergenic
902134268 1:14291478-14291500 GGACCTGCCGAGCCAGGCATGGG + Intergenic
902385869 1:16075440-16075462 AGAGCAGCTGAGCCAGGGAGTGG + Intergenic
902644863 1:17791080-17791102 GCTGCAGCTGTGCCTGGCAGGGG + Intronic
902688325 1:18093493-18093515 GCAGCTTCAGAGGCAGCCAGGGG + Intergenic
902844016 1:19095360-19095382 GCAGGAGGTGAGCCAGCCAGAGG + Intronic
902959822 1:19955370-19955392 GCAGCTGTGGAGGCAGGGAGAGG - Intergenic
903066996 1:20705205-20705227 GGAGCTGCTGTGGCAGCCAGAGG - Intronic
903131342 1:21281287-21281309 GAAGCAGCTGGGTCAGGCAGTGG + Intronic
903315569 1:22502062-22502084 AAAGCTGCAGAGCCAGCCAGAGG - Intronic
903572604 1:24317482-24317504 CAAGCTGCAGAGCTAGGCAGTGG - Intergenic
903794719 1:25920126-25920148 GCAGAGGCTAACCCAGGCAGCGG + Intergenic
905209733 1:36365929-36365951 GTATCTGCTGGGCCTGGCAGTGG - Intronic
905307456 1:37029478-37029500 GCAGCTGCTGTGGCAAGTAGAGG + Intronic
905497376 1:38403397-38403419 GCAGTTGGTGAGCAAGGCTGAGG - Intergenic
905843428 1:41205392-41205414 GGACCTGCCGAGCCAGGCACAGG - Intronic
905894479 1:41536172-41536194 GAAGCTGCTCTGCCATGCAGTGG + Intronic
906535492 1:46548818-46548840 GGAGCTGCTCAGTCAGGGAGGGG + Intronic
906570145 1:46830967-46830989 GGACCTGCTGAGCCAGGCACAGG + Intergenic
906646629 1:47479781-47479803 GCAGCTGGCGAGGCAGGAAGAGG - Intergenic
906696811 1:47828675-47828697 GCAGCTTCTGAGAGAGGCTGAGG - Intronic
906835053 1:49074186-49074208 GGACCTGCTGAGCCAGGCACCGG + Intronic
907045778 1:51299293-51299315 GCCGCTGCTGACTCTGGCAGGGG + Intronic
907304693 1:53507003-53507025 GCAGCTGGGGAGACAGGCACGGG + Intronic
907447622 1:54519114-54519136 GCAGGGGCTGCTCCAGGCAGAGG + Intergenic
907520545 1:55020701-55020723 GGAGATTCTGGGCCAGGCAGAGG + Intergenic
907870713 1:58440211-58440233 TAAGCTGCAGAGGCAGGCAGAGG - Intronic
907929413 1:58985446-58985468 GCAGAAGCTGAGCCAGTCACAGG - Intergenic
908315345 1:62927113-62927135 GAGGCTGGTGAGGCAGGCAGCGG + Intergenic
908444381 1:64187735-64187757 GCAGCTGCTGATGGAGGGAGGGG - Intergenic
908576719 1:65467832-65467854 GGACCTGCTGAGCCAGGCACAGG + Intronic
910281727 1:85508670-85508692 GGACCTGCGGAGCCAGGCACAGG - Intronic
911039656 1:93581972-93581994 GCAGCTGCTGATGCCAGCAGGGG + Intronic
911110475 1:94178807-94178829 GCAGAAACTGAGCCAGGTAGAGG - Intronic
911596131 1:99800704-99800726 GGACCTGCTGAGCCAGGCACAGG + Intergenic
912646160 1:111394085-111394107 GGACCTGCCGAGCCAGGCACAGG - Intergenic
912690805 1:111803274-111803296 GCAGGTGCTGTGCGAGGCTGTGG - Intronic
912745640 1:112243438-112243460 GTAGCTTCTGAGCCAGGGATGGG - Intergenic
912886377 1:113479043-113479065 GGAGCTGCCAAGCCAGGCATGGG + Intronic
913702300 1:121384947-121384969 TCAGTGGCTGAGCCAGGCAGGGG + Intronic
914042863 1:144065442-144065464 TCAGTGGCTGAGCCAGGCAGGGG + Intergenic
914135223 1:144895046-144895068 TCAGTGGCTGAGCCAGGCAGGGG - Intronic
914913688 1:151805344-151805366 GCAGCCGGGCAGCCAGGCAGCGG - Exonic
914950482 1:152109652-152109674 GCAGCTGCTGAGAGAGGAACAGG - Exonic
914950495 1:152109742-152109764 GCAGCTGCTGAGAGAGGAACCGG - Exonic
914950509 1:152109832-152109854 GCAGCTGCTGAGAGAGGAACGGG - Exonic
914950525 1:152109922-152109944 GCAGCTGCTGAGAGAGGAACCGG - Exonic
914950553 1:152110102-152110124 GCAGCTGCTGAGAGAGGAACGGG - Exonic
914950564 1:152110192-152110214 GCAGCTGCTGAGAGAGGAACGGG - Exonic
914950590 1:152110372-152110394 GCAGCTGCTGAGAGAGGAACGGG - Exonic
914958898 1:152189018-152189040 GCAGCTGCTGGGCCCGGTCGCGG + Intergenic
915118067 1:153612696-153612718 TCAGCTGCTGCGGCAGGGAGGGG + Intronic
915163574 1:153935812-153935834 TCAGCCGCTAAGCCAGGCACGGG - Intronic
915971732 1:160360023-160360045 GCAGCGGCTGAGTCAGCCAAGGG + Intergenic
916069356 1:161160905-161160927 GGGGGTGGTGAGCCAGGCAGGGG - Exonic
916075198 1:161196623-161196645 GCAGCTTCTGTGCCTGGCAGCGG - Exonic
916330838 1:163614737-163614759 GGAGCTTCAGAGCCAGGCACAGG + Intergenic
917151128 1:171946004-171946026 GCAGCTGGAGAGACAGGGAGGGG + Intronic
917181428 1:172302220-172302242 GGACCTGCTGAGCCAGGCGTGGG - Intronic
917764156 1:178199097-178199119 GGACCCGCTGAGCCAGGCATGGG + Intronic
917827397 1:178837883-178837905 GCACCCTCTGAGCCAGGCACGGG - Intronic
917837753 1:178954208-178954230 GCAGCTTCTGACACAGGCAGCGG + Intergenic
917971603 1:180211565-180211587 GCAGCTGGAGAGGTAGGCAGTGG - Intergenic
918265192 1:182835980-182836002 GCTGCTGCTGTGACAGGAAGCGG + Intergenic
918364725 1:183795594-183795616 GAAGCTGAAGAGGCAGGCAGGGG + Intronic
919012917 1:191988422-191988444 GCAGCTGCTGAGGTTGGAAGGGG - Intergenic
919395648 1:197044224-197044246 GAAACTGCTGAGCCAGGCAAGGG - Intronic
919770270 1:201154144-201154166 CCACCTGGTGAGCCCGGCAGAGG + Exonic
919799890 1:201347592-201347614 GCAACTGATGAGCCCTGCAGGGG + Intergenic
919803220 1:201365828-201365850 CCAGGTGCTGAGCAAGGCTGAGG - Intronic
920489726 1:206403688-206403710 TCAGTGGCTGAGCCAGGCAGGGG + Intronic
920681639 1:208077479-208077501 GCAGCTGCTGGGGCTGGCAGAGG + Intronic
920844124 1:209579274-209579296 GCAGCTGGTGAGGCAGGAAAAGG - Intergenic
921893360 1:220374652-220374674 GTTGCTGCTGAGTCATGCAGTGG - Intergenic
922184387 1:223261075-223261097 TCAGCCAGTGAGCCAGGCAGAGG - Intronic
922783055 1:228268723-228268745 GCAGCAGGCGGGCCAGGCAGAGG + Exonic
923034620 1:230276879-230276901 GCATCTGCTGAGCCAAGTACTGG + Intronic
923194473 1:231651882-231651904 GGACCTGCTGAGCCAGGCACAGG + Intronic
923538523 1:234871426-234871448 GCCCCGGCTGAGGCAGGCAGAGG - Intergenic
924816168 1:247443875-247443897 GCAGCTGCTGAGAGAGGACGAGG + Intronic
924862444 1:247937687-247937709 GCGGCAGCTGAGCCTGGGAGAGG - Intronic
1063114651 10:3065668-3065690 GCAGCTCCTGAGCCCAGCGGTGG + Intergenic
1063464165 10:6232352-6232374 CCAGGTGGGGAGCCAGGCAGAGG - Intronic
1063967471 10:11357899-11357921 GAGGCTGGAGAGCCAGGCAGGGG + Intergenic
1064492889 10:15878334-15878356 GGACCTGCTGAGCCACGCACGGG + Intergenic
1064769395 10:18708375-18708397 TGAGCTGCTGCACCAGGCAGTGG - Intergenic
1065119404 10:22514164-22514186 GGACCTGCTGAGCCAGGCACCGG + Intergenic
1065231058 10:23598905-23598927 GGACCTGCTGAGCCAGGCACAGG + Intergenic
1066362194 10:34742014-34742036 GCAGTTCCTGTGCCAGGCAATGG - Intronic
1067069968 10:43124152-43124174 GGAGGTGCAGAGCCAGGCAGGGG + Intronic
1067216955 10:44311140-44311162 GCAGCGGGTGATGCAGGCAGGGG - Intergenic
1067239772 10:44480634-44480656 GGAGCTGCTGAGCCAGGCACGGG - Intergenic
1067450380 10:46378389-46378411 TCAGCTTCTGAGTCAGGCTGGGG + Intronic
1067450785 10:46380749-46380771 GCAGTTGCTGGGCCAGGCCTCGG + Intronic
1067586458 10:47479002-47479024 GCAGTTGCTGGGCCAGGCCTCGG - Intronic
1067586865 10:47481374-47481396 TCAGCTTCTGAGTCAGGCTGGGG - Intronic
1067633920 10:47989141-47989163 TCAGCTTCTGAGTCAGGCTGGGG - Intergenic
1067766340 10:49090457-49090479 TCAGCTGGTGAGCCAGACAATGG + Intronic
1067774769 10:49155195-49155217 GCAGATGCTGTGCCTTGCAGAGG - Intronic
1067817640 10:49494605-49494627 CCTGCTTCTGAGCCAGGCAGTGG - Intronic
1068502136 10:57853486-57853508 GCAGCTGCAGACCCAAGCAAGGG + Intergenic
1069300330 10:66899700-66899722 GTACCTGCTGAGCCAGACATGGG - Intronic
1069732464 10:70626557-70626579 GGAGCTTCTGAGCCAGGAAAAGG - Intergenic
1070007169 10:72435739-72435761 GGACATGCTGAGCCAGGCACCGG - Intronic
1070793571 10:79203916-79203938 TCTGCTTTTGAGCCAGGCAGTGG + Intronic
1071559432 10:86633458-86633480 GCTGCTGCAGAGCGCGGCAGTGG + Intergenic
1071562890 10:86657045-86657067 TCAGCCACTGAGCCAGGCAGGGG - Intronic
1071671937 10:87616957-87616979 GCATATGCTGTTCCAGGCAGAGG + Intergenic
1071698496 10:87903640-87903662 GGACCTGCTGAGCCAGGCACGGG + Intronic
1072380008 10:94858319-94858341 GGTCCTGCTGAGCCAGGCATAGG + Intergenic
1072516231 10:96186015-96186037 GGACCTGCTGAGCCAGGCGCCGG + Intronic
1072704841 10:97673739-97673761 GTAGCTCCAGAGGCAGGCAGAGG + Exonic
1073045682 10:100636941-100636963 GCAGCTGGGGAGCCAGTGAGTGG + Intergenic
1073330834 10:102669030-102669052 TGAGATGCTGATCCAGGCAGTGG - Intergenic
1073436825 10:103522052-103522074 GGAGCTTCTGAGCCAGGAGGAGG + Intronic
1073978896 10:109131735-109131757 GAACCTGCTGATCCAGGCACAGG - Intergenic
1074393436 10:113077130-113077152 GCAGGAACTCAGCCAGGCAGTGG + Intronic
1074437413 10:113445895-113445917 GCCTCTGCTCAGCCGGGCAGTGG + Intergenic
1075477249 10:122746596-122746618 GCAGATGCTGAGTCAGCCACAGG - Intergenic
1075591109 10:123692363-123692385 ACAGGAGCTGAGCCAGGCTGAGG + Exonic
1075705049 10:124495459-124495481 GAAGCATCTGAGGCAGGCAGTGG + Intronic
1075729830 10:124629523-124629545 GCAGCTGCCAGGCCAGGCTGGGG - Intronic
1075745608 10:124725273-124725295 GCAGGTGCAGAGCCAGGAAATGG - Intronic
1076203096 10:128573401-128573423 GCAGCGGTGGAGCCTGGCAGCGG + Intergenic
1076478079 10:130766448-130766470 ACAGATGATGAGACAGGCAGAGG + Intergenic
1076527952 10:131124219-131124241 GCAGCTCAGGAGCCTGGCAGCGG - Intronic
1076745381 10:132510241-132510263 GTAGCTGCGGAGCTAGGCACAGG - Intergenic
1076856515 10:133117932-133117954 CCAGCTGCTGTCCCAGACAGGGG - Intronic
1076858327 10:133128076-133128098 GTAGAGGCAGAGCCAGGCAGGGG - Intronic
1076878671 10:133229833-133229855 GCAGGTGCTGAGCCCGGGCGGGG + Intergenic
1076885453 10:133260128-133260150 GCACCTGCAGAGCCAGGCATGGG + Intergenic
1076907898 10:133372661-133372683 CCTCCTGCAGAGCCAGGCAGGGG + Intronic
1077090907 11:777780-777802 GCATCAGCAGAGCCAGGCGGCGG + Intronic
1077466052 11:2734269-2734291 CCAGCTGCAGAGCAGGGCAGGGG + Intronic
1077483241 11:2826392-2826414 GCGGCTGCTGGGCCTGGCCGCGG - Intronic
1077540201 11:3143048-3143070 GCAGGTGCGGAGCGGGGCAGAGG + Intronic
1077540214 11:3143098-3143120 GCAGGTGCAGAGCCGGGCAGAGG + Intronic
1077540228 11:3143148-3143170 GCAGGTGCAGAGCCGGGCAGAGG + Intronic
1077540234 11:3143173-3143195 GCAGGTGCAGAGCCGGGCAGAGG + Intronic
1077540260 11:3143247-3143269 GCAGGTGCGGAGCGGGGCAGAGG + Intronic
1077710474 11:4531758-4531780 GGTCCTGCTGAGCCAGGCACGGG - Intergenic
1078143771 11:8709537-8709559 CCAGGTGGTGAGCCAGGCAGAGG - Intronic
1078482623 11:11691868-11691890 AGAGCTGCAGAGCCAGGCACGGG - Intergenic
1078689997 11:13570168-13570190 GGACTTGCTGAGCCAGGCATGGG - Intergenic
1079355353 11:19726006-19726028 GCCTCGGCAGAGCCAGGCAGAGG - Intronic
1080233765 11:30046106-30046128 GCAGCTGCTGATAAAGGGAGGGG - Intergenic
1081462161 11:43281866-43281888 GCAGATGCTGTGCCAGGCTCTGG + Intergenic
1081682420 11:45017604-45017626 GGACCCGCTGAGCCAGGCATGGG + Intergenic
1081739954 11:45431873-45431895 GAGGCTGCTGAACCTGGCAGTGG - Intergenic
1081907806 11:46680404-46680426 GAAGCTGCTGGGCAGGGCAGAGG - Intronic
1081950825 11:47040997-47041019 GCAGCAGCTGGGGCTGGCAGTGG + Intronic
1082820403 11:57541039-57541061 GGAGCCGCTGAACCAGGAAGGGG + Intergenic
1082945102 11:58749952-58749974 GGACCTGCTAAGCCAGGCACAGG - Intergenic
1083636753 11:64125015-64125037 GCAGGAGCTGTCCCAGGCAGGGG - Intronic
1083671890 11:64304568-64304590 GCAGCTCCTTAGTCAGGAAGTGG - Exonic
1083677590 11:64335174-64335196 GCCTCAGCTGAGTCAGGCAGAGG - Intergenic
1084169878 11:67395967-67395989 GCAGCTGCAGGCCCAGGAAGGGG + Exonic
1084266220 11:68006696-68006718 GCATTTGCTGTGCCAGGCACTGG - Intergenic
1084703447 11:70802333-70802355 AGAGCTGCTGAGGCAGGGAGCGG - Intronic
1084752458 11:71213202-71213224 GCAGCTGAGGGGCCAGGCACAGG + Intronic
1084891540 11:72239382-72239404 GCCGCTGCAGAGCCAGGGAAGGG + Exonic
1084957674 11:72699884-72699906 GCAGCTGGAGAGACGGGCAGGGG - Intronic
1085015318 11:73170064-73170086 GCAGCCACTGGGCCAAGCAGTGG + Intergenic
1085313662 11:75530803-75530825 GTGGCTGGAGAGCCAGGCAGAGG + Intergenic
1085706176 11:78788443-78788465 GAAGCTCCTGAGCCTGGCATAGG - Intronic
1086009438 11:82081894-82081916 GCAGCTGCTGAGCAAGAAATAGG - Intergenic
1086117312 11:83266454-83266476 GGACCCGCTGAGCCAGGCACAGG - Intronic
1086307358 11:85496250-85496272 AGACCTGCTGAGCCAGGCACAGG - Intronic
1086644987 11:89209289-89209311 GGACCTGCTGAGCCAGGCATGGG - Intronic
1087003466 11:93444865-93444887 GGAGCTGCCAAGCCAGGCAGGGG + Intergenic
1087040239 11:93792061-93792083 TAAGCTGCTGAGGCAGTCAGCGG + Intronic
1088197712 11:107294046-107294068 GGACCCGCTGAGCCAGGCACGGG - Intergenic
1088851114 11:113704162-113704184 GCAGCTCATGAGCCATGAAGAGG + Intronic
1088887556 11:114019739-114019761 GCAGCTGCAGTAGCAGGCAGGGG + Intergenic
1089347214 11:117798000-117798022 GCACCTGCTGTGTCAGGCACTGG + Intronic
1089496932 11:118912710-118912732 CCAGCTGGTGAGCCAAGCAGAGG - Intronic
1089874746 11:121709228-121709250 GCAGACCCTGTGCCAGGCAGTGG - Intergenic
1090224783 11:125063420-125063442 ACAGCTGGTGAGCGGGGCAGGGG + Exonic
1090673553 11:128969062-128969084 GCTGGTGCTGAGGCAGGGAGTGG + Exonic
1090787188 11:130060152-130060174 ACAGGTGCTCAGCCAGGCAAAGG - Intergenic
1090815945 11:130295713-130295735 GCAGCTGCAAAAACAGGCAGTGG + Intronic
1091045151 11:132318706-132318728 GCAGCTGTGAAGCCAGGGAGGGG + Intronic
1091225349 11:133953785-133953807 ACGGCTGCTGAGCCAGCCCGGGG - Intronic
1091349184 11:134879457-134879479 GCAGCTGCTGATGCAGACGGAGG + Intergenic
1091384629 12:85267-85289 GCAGCCTCAGAGCCTGGCAGAGG + Intronic
1091421311 12:343123-343145 GGACCTGCGGAGCCAGGCATGGG - Intronic
1091567848 12:1661752-1661774 GCAGTGGGAGAGCCAGGCAGGGG - Intergenic
1091582704 12:1798780-1798802 GCAGCTGCTGACAGAGACAGAGG + Intronic
1092244787 12:6857666-6857688 ACAGGTGCTCAGCCAGGCTGGGG - Exonic
1093085946 12:14867139-14867161 GGAGCCTCTGAGCCAGGCATGGG + Intronic
1093199805 12:16172897-16172919 CCAGCTTCAGAGACAGGCAGCGG + Intergenic
1093597697 12:20981524-20981546 GGACCTGCTGAGCCAGGCATGGG + Intergenic
1093649575 12:21627369-21627391 GGACCCGCTGAGCCAGGCATGGG + Intergenic
1093891602 12:24528107-24528129 GCTGCATATGAGCCAGGCAGAGG - Intergenic
1093992897 12:25610131-25610153 GGACCTGCTGAGCCATGCATGGG + Intronic
1094647718 12:32342982-32343004 GCAGAAGCTGAGCCAGCCAGAGG - Intronic
1094759967 12:33521064-33521086 GGACCCGCTGAGCCAAGCAGGGG - Intergenic
1094791532 12:33920721-33920743 GGACCTGCTGAGCCAGGCACGGG + Intergenic
1095097072 12:38154605-38154627 GCAGCCCCTGAGCCAGGCCCTGG + Intergenic
1095482381 12:42649831-42649853 TCCGCTGTTGGGCCAGGCAGTGG + Intergenic
1095891109 12:47235774-47235796 GCAGCAGCTGGGAGAGGCAGCGG - Exonic
1095989329 12:48023550-48023572 TCAGCTGCTGTGCCAGTCACCGG - Intronic
1096505172 12:52088072-52088094 GCAGCTACTGTCCCAGGCACTGG + Intergenic
1096584561 12:52611406-52611428 GCACTTGCAGAGCCTGGCAGAGG + Intronic
1096674199 12:53217713-53217735 GCAGCTCCTGGGTTAGGCAGGGG + Intronic
1097004004 12:55901964-55901986 GCAGCAGCGGATCCAGGCTGGGG - Exonic
1097365733 12:58710162-58710184 GGACCTGCTGAGCCAGGCATGGG + Intronic
1097749584 12:63337210-63337232 GGACCTGCTGAGCCAGGCATGGG - Intergenic
1098425993 12:70366309-70366331 GCAGCTGCCGGGCGAGTCAGCGG + Exonic
1100237559 12:92675713-92675735 GCAGGTGCTGAGCTAGACAGAGG - Intergenic
1100301227 12:93309797-93309819 AAAGCTGCTGATTCAGGCAGAGG + Intergenic
1100808284 12:98311075-98311097 GGTGCTGCTGAGCCAGGCACGGG - Intergenic
1101059319 12:100954544-100954566 GCAGCTTCTCAGCAATGCAGAGG + Intronic
1101830209 12:108251090-108251112 GTAGGAGCTGGGCCAGGCAGAGG + Intergenic
1102552585 12:113702405-113702427 GCATCTCCAGAGTCAGGCAGAGG - Intergenic
1103175129 12:118856560-118856582 CATGCTGCTGAGCTAGGCAGAGG + Intergenic
1103200939 12:119087414-119087436 GGAGCTTCTGAGCCAGGCCCTGG - Intronic
1103461680 12:121109789-121109811 GCAGCTGCTGAGACAGGGAAAGG + Intergenic
1103924421 12:124415677-124415699 GAAGCTGCCGTTCCAGGCAGGGG - Intronic
1104748699 12:131224880-131224902 GGAGGGGCAGAGCCAGGCAGGGG + Intergenic
1104784425 12:131440684-131440706 GGAGGGGCAGAGCCAGGCAGGGG - Intergenic
1105214342 13:18275455-18275477 GAAACTGCTGAGCAGGGCAGGGG - Intergenic
1106023964 13:25940132-25940154 GAAGCTGCTGTGACAGGCACGGG - Intronic
1106586011 13:31056599-31056621 CCAGCTGCAGAGCTAGCCAGAGG - Intergenic
1107453673 13:40535479-40535501 GGAGCTGCTGGGCCCGGCTGCGG - Intergenic
1108170332 13:47735109-47735131 GGACCTGCCGAGCCAGGCATGGG - Intergenic
1108188078 13:47908286-47908308 GGACCTGCTGAGTCAGGCACAGG - Intergenic
1108508598 13:51135159-51135181 ACAGCTGCTCAGCCTGGCAGTGG + Intergenic
1108988752 13:56629025-56629047 GGACCTGGTGAGCCAGGCACGGG - Intergenic
1109465838 13:62730014-62730036 GGACCCGCTGAGCCAGGCACGGG + Intergenic
1109816215 13:67588667-67588689 GGAACTGCAGAGCCAGGCATGGG - Intergenic
1109963873 13:69667073-69667095 GGAGCTGCCAAGCCAGGCATGGG - Intergenic
1109968699 13:69737273-69737295 GCAGCTGCTGGAGCAGGCACTGG + Intronic
1110818537 13:79887378-79887400 GTACCTGCCGAGCCAGGCACAGG - Intergenic
1110876507 13:80517192-80517214 GAACCTGCTGAGCCAGACACGGG - Intergenic
1112112708 13:96320697-96320719 CCAGCTGCTGGGCCATGCTGGGG - Intronic
1113323908 13:109265279-109265301 GGAGCTGCTGAGCCAGGAGAAGG - Intergenic
1113569692 13:111345103-111345125 ACAGCCGCAGAGCCAAGCAGCGG - Intergenic
1113767996 13:112892864-112892886 GCTGCTGCTGCTCCAGGGAGCGG + Intergenic
1113895224 13:113759898-113759920 GCAGCCTCGGAGCCAGGCAAAGG + Intronic
1114444857 14:22780568-22780590 GCAGCTGAGCTGCCAGGCAGTGG - Intronic
1114549463 14:23524697-23524719 GGAGGAGCTGAGCCAAGCAGAGG - Exonic
1114555107 14:23557361-23557383 GCACCTGCTGGACCATGCAGTGG + Intronic
1114599480 14:23942766-23942788 GGACCTGCTGAGCCAGGCACGGG - Intergenic
1114677528 14:24453696-24453718 GGACCTGCTGAGCCAGGCATGGG + Intergenic
1114964362 14:27939283-27939305 GGATCTGCTGAGCCAGGCACAGG - Intergenic
1115522441 14:34246390-34246412 GCATATGCTGAGCTAGGTAGGGG - Intronic
1115584593 14:34798021-34798043 GGACCCGCTGAGCCAGGCACGGG - Intronic
1115857991 14:37651869-37651891 GAAGCTGGAGAGGCAGGCAGTGG + Intronic
1116236493 14:42285438-42285460 GGACCTGCTGAGCCAGGCAAGGG + Intergenic
1116937596 14:50758152-50758174 GGAGGTCCTGTGCCAGGCAGGGG - Exonic
1116953111 14:50896581-50896603 GCAGCTTCTGAGCCAGGAGAAGG - Intronic
1117017650 14:51534829-51534851 AAAGCTGATGAGCCAGGCAGAGG + Intronic
1117081676 14:52158094-52158116 GGACCTGCCGAGCCAGGCACAGG - Intergenic
1117757648 14:58992181-58992203 TCAGCTGCAGGTCCAGGCAGGGG - Intergenic
1117759353 14:59010354-59010376 CCACCTGCTGACCCAGGCACTGG + Intergenic
1117900643 14:60529083-60529105 GGATCTGCTGAGCCAGGCACGGG + Intergenic
1118576087 14:67241964-67241986 CCAGCAGCTGAGTCAGGCAGAGG - Intronic
1118765435 14:68906558-68906580 GCAGCTGCTGCTCCAGGCCCTGG - Intronic
1118885932 14:69865901-69865923 GCAGCTGGTGGACAAGGCAGCGG + Intronic
1119731896 14:76956487-76956509 GCGGCAGCCGGGCCAGGCAGGGG - Intergenic
1119765480 14:77185005-77185027 GCTGGTGCTGAGACATGCAGAGG + Intronic
1120065752 14:80039126-80039148 GGAACTGCTGAGCTAGGCAAGGG - Intergenic
1120559652 14:85974851-85974873 GGACCTGCTGAGCCAGGCATGGG + Intergenic
1120619916 14:86750795-86750817 GGACCTGCTGAGCCAGGCATGGG + Intergenic
1120826549 14:88961391-88961413 GCAGGTGCTGTGCCAGGCAATGG + Intergenic
1121012401 14:90528187-90528209 GCTGCTGTTTAGCCAGCCAGGGG - Exonic
1121315649 14:92959555-92959577 GCAGCTCTGGAGTCAGGCAGGGG + Intronic
1121419150 14:93800198-93800220 GCAGATTCTGTGCCAGGCTGTGG + Intergenic
1122363314 14:101180183-101180205 GCAACTGCCAAGCCTGGCAGCGG - Intergenic
1122723671 14:103736376-103736398 GCAGCAGCTGGGCCGGGCAGGGG - Intronic
1122976013 14:105171061-105171083 GCAGCTGCTCAGCCTGGCCAGGG + Intergenic
1123450954 15:20358449-20358471 ACAGATGGTGGGCCAGGCAGGGG + Intergenic
1124355317 15:28991174-28991196 GATGGTGCTGAGACAGGCAGAGG - Intronic
1124635236 15:31360914-31360936 GCAGGTGCTGGGCCTGGAAGAGG + Intronic
1124935494 15:34166286-34166308 GGACCTGCCGAGCCAGGCATAGG - Intronic
1124948415 15:34292807-34292829 GGACCTGCTGAGCCAGGCATGGG + Intronic
1125510269 15:40288937-40288959 GCCCCTCCTGAGCCAGGCAGGGG - Intronic
1125608609 15:40956320-40956342 ACAGCTGCTGAGCCTGGCCTGGG + Exonic
1125832841 15:42728737-42728759 GCAGCTGGTGACACAGGGAGAGG - Exonic
1125984717 15:44038878-44038900 GGACCTGCCGAGCCAGGCACTGG - Intronic
1126854437 15:52824293-52824315 GGACCTGCTGAGCCGGGCATGGG - Intergenic
1127533987 15:59872816-59872838 GCAGCTGCAAAAACAGGCAGTGG - Intergenic
1127570607 15:60237494-60237516 GGACCTGCCGAGCCAGGCACAGG - Intergenic
1128079633 15:64848706-64848728 CCAGCAGCTGGGCCTGGCAGAGG - Exonic
1128261266 15:66234730-66234752 GCAGCAGCAGAGGAAGGCAGTGG - Intronic
1128548308 15:68581853-68581875 GCTGCTGCTTCTCCAGGCAGAGG + Intronic
1128738926 15:70070248-70070270 GCACCTTCTGAGCCAGGCCATGG - Intronic
1129479394 15:75811035-75811057 GTGGCTGCAGAGGCAGGCAGGGG - Intergenic
1129572464 15:76702929-76702951 AAAGCTGCTGAGCTAAGCAGTGG - Exonic
1130029068 15:80295459-80295481 GCAGCTGCTCTCCCAGGCACAGG - Intergenic
1130800904 15:87262370-87262392 GGACCTGCTGAGCCAGGCATGGG + Intergenic
1131116472 15:89799228-89799250 TCTGCAGCTGAGCCAGGCAGCGG + Intronic
1131431742 15:92393887-92393909 GCAGCGGCAGCGACAGGCAGGGG - Exonic
1132222656 15:100116704-100116726 GCCGCAGCTGAGCTGGGCAGAGG + Intronic
1132547697 16:540837-540859 GCAGCTCCTGAGGGACGCAGCGG - Intronic
1133051966 16:3122076-3122098 GCAGCTGCTCTTCCAGGCACAGG + Intergenic
1133636107 16:7667283-7667305 TCTGCTGCTGAGCTGGGCAGTGG - Intronic
1134596060 16:15496906-15496928 GCAGGGGCAGAGCCAGGCAGGGG + Intronic
1134689035 16:16178917-16178939 GCAGCGGCTGAGCCTGGCCCGGG - Exonic
1134810892 16:17166211-17166233 GCAGCAGCTGCTCCAGGCATGGG - Intronic
1135771913 16:25224330-25224352 GAAGCTGCTGAGCCTCACAGTGG - Intronic
1136130395 16:28216944-28216966 GCTGTTGCTGACCCAGACAGTGG - Intergenic
1136272784 16:29158429-29158451 GGCTCTGCTGAGGCAGGCAGTGG - Intergenic
1136283463 16:29228082-29228104 GCAGGTGCTGGGCCACGCTGGGG - Intergenic
1136616499 16:31401587-31401609 CCAGCGGCTGACCCTGGCAGAGG + Intronic
1137046126 16:35664068-35664090 GGACCTGCTGAGCCAGGCATGGG - Intergenic
1137461518 16:48668434-48668456 GGACCTGCTGAACCAGGCATGGG + Intergenic
1137836792 16:51599590-51599612 GCACTTGCTGAGTCTGGCAGAGG - Intergenic
1138202344 16:55099584-55099606 GAATCAGCTGATCCAGGCAGTGG - Intergenic
1138448246 16:57077976-57077998 GCAGCTCCTGAGCCAGCCCCAGG - Exonic
1138450486 16:57091289-57091311 GCAGCAGGAGAGCCAGGCACTGG - Intergenic
1138597294 16:58035833-58035855 GCAGCTGCTGACCCAAGGAGGGG - Intronic
1139287967 16:65832325-65832347 GCAACTGCTGAGCTTGGTAGAGG - Intergenic
1139418893 16:66836119-66836141 TCAACTGCTGGGCCAGGCACAGG - Intronic
1139572876 16:67824304-67824326 GCACCTCCTGAGCCTGGCAGGGG - Intronic
1140410465 16:74737855-74737877 TCTGTTGCTGACCCAGGCAGCGG - Intronic
1140648256 16:77057613-77057635 GCAGCTGGGCTGCCAGGCAGGGG + Intergenic
1141389141 16:83649777-83649799 TCTGCTGCTGAGAGAGGCAGGGG + Intronic
1141422311 16:83925188-83925210 GCTGCTGCTGAGCTATGCAGGGG - Exonic
1141499207 16:84431971-84431993 GCACCTGCAGAGGCAGGCACTGG + Intronic
1141559150 16:84855071-84855093 GCATCTGCAGAGCCCGGCACAGG - Intronic
1141607173 16:85160708-85160730 GCAGCTGCTCTGGAAGGCAGGGG + Intergenic
1142076341 16:88120241-88120263 GGCTCTGCTGAGGCAGGCAGTGG - Intergenic
1142196463 16:88741526-88741548 GCAGATGCCGAGGCAGACAGAGG + Exonic
1142416587 16:89946713-89946735 ACAGAGGCTCAGCCAGGCAGGGG + Intergenic
1142421260 16:89972086-89972108 GCAGCAGCTGGGCTAGGCAGTGG - Exonic
1142441407 16:90100714-90100736 GCAGCTGCTGAGAACGGCTGTGG - Intergenic
1142627119 17:1199199-1199221 GCACCTGCAGAGCCAGAGAGAGG - Intronic
1142849230 17:2696276-2696298 AGAGAGGCTGAGCCAGGCAGTGG + Intronic
1143282447 17:5764955-5764977 GCAGTTGCTAAGCCAGGAGGGGG + Intergenic
1143750511 17:9023440-9023462 GGAGCTGCTGGGCCTCGCAGCGG + Intronic
1144480145 17:15622238-15622260 GCCGCTGCTGGGCCAGATAGAGG + Intronic
1144918160 17:18741500-18741522 GCCGCTGCTGGGCCAGATAGAGG - Intergenic
1145035724 17:19539281-19539303 GCAGCTGCTGAGACATCTAGCGG + Intronic
1145956875 17:28860770-28860792 GTAGCTGTGGTGCCAGGCAGAGG - Exonic
1146632807 17:34483072-34483094 GCAGCTGCTGATGCAGCCCGGGG + Intergenic
1146716435 17:35089941-35089963 GAAGCTGCTGAGGAAGGCTGTGG + Intronic
1147163746 17:38582386-38582408 CCAGCTGCTGGAGCAGGCAGAGG + Intronic
1147945761 17:44079236-44079258 GCAGCTGATGACCCTGGCAGGGG - Exonic
1148002415 17:44397650-44397672 GCAGCTGCTGCAGCAGGCCGTGG + Exonic
1148462331 17:47845932-47845954 GCAGAAGCTGAGCCAGGCAGAGG - Exonic
1148469179 17:47883012-47883034 GCAGTAGCTCAGCCTGGCAGTGG + Intergenic
1148791851 17:50177706-50177728 GCATCTGCTGAGGCAGGCTGAGG + Intergenic
1148818851 17:50348741-50348763 GGAGCTACAGAGCCAGGAAGTGG + Intronic
1149191948 17:54073218-54073240 GGACCTGCTGAGCCAGGCATGGG + Intergenic
1149536803 17:57439521-57439543 GCAGGTCCTGTGCCAGGCACTGG + Intronic
1150069281 17:62138295-62138317 GCAGGTGCTGCGCCAGCGAGAGG + Intergenic
1150094098 17:62357271-62357293 GGACCTGCTGAGCCAGGCATGGG - Intergenic
1150214566 17:63459511-63459533 GCAGGGGCAGAGGCAGGCAGAGG + Intergenic
1150220212 17:63491772-63491794 GCAGCTTCTGAGCCTGTCAGGGG - Intronic
1151415113 17:73957040-73957062 GCAGCCACGGAGCCAGCCAGTGG - Intergenic
1151565873 17:74897999-74898021 CCAGCTGCTGAGGGAGGCTGAGG - Intergenic
1151764787 17:76127170-76127192 ATGGCTGCTGAGCCAGGAAGGGG - Intergenic
1152068795 17:78125219-78125241 GGAGCTCCAGAGCCTGGCAGTGG - Exonic
1152267818 17:79306545-79306567 GCAGCCTCTGAGCCTGGGAGAGG + Intronic
1152277546 17:79367009-79367031 GCAGCTCCAGAGCTACGCAGAGG + Intronic
1152722691 17:81930690-81930712 GCAGAAGCTGAGCCAAGCAGAGG + Intergenic
1152740299 17:82015777-82015799 GAAGCTGGGGAGCCAGGAAGGGG - Intronic
1152924764 17:83081703-83081725 ACACCTGCAGAGCCTGGCAGAGG + Intronic
1152944307 17:83190784-83190806 GGAGCAGCTGAGCCAGGAAGTGG - Intergenic
1152948514 17:83211801-83211823 ACAGCTGCAGAGGGAGGCAGGGG + Intergenic
1153064934 18:1035099-1035121 GGACCTGCTGAGCCAGGCATAGG + Intergenic
1154162949 18:11993632-11993654 GCAGTAGCTGACCCAGGAAGAGG + Intronic
1155208184 18:23578536-23578558 GCAGCTGCAGAGGCAGGCCTGGG - Intronic
1155562484 18:27093539-27093561 GGAGCCACTGAGCCAGGCATGGG + Intronic
1156041328 18:32826295-32826317 GCAGTTACTGCGCCAGCCAGTGG - Intergenic
1156396326 18:36703305-36703327 CCAGGGGCTGAGCCAGGGAGAGG + Intronic
1157405446 18:47418855-47418877 GAAGCAGCTGAGCCCAGCAGAGG - Intergenic
1157413455 18:47482836-47482858 TCAGGTGCTGAGCCAGGTACTGG - Intergenic
1157486365 18:48090201-48090223 GCAGGTGCTGGGCCAGTCACAGG + Intronic
1157609968 18:48950079-48950101 GGAGCTGCTGCTCCAGGCCGTGG - Exonic
1157718346 18:49904812-49904834 GCAGGTGCTCAGCCAGCCTGGGG + Exonic
1157772217 18:50359047-50359069 GAAGCTGATGAGGCAGGCAGGGG + Intergenic
1157920144 18:51706367-51706389 GGACCTTCTGAGCCAGGCACAGG + Intergenic
1158659325 18:59371852-59371874 GCAGCTGCTTTGCCACGCTGTGG + Intergenic
1158665324 18:59427638-59427660 GGAGATGCAGAGGCAGGCAGGGG - Intergenic
1158703699 18:59771682-59771704 GAACCTGCAGAGCCAGGCACAGG - Intergenic
1158950276 18:62488104-62488126 GGAGCTGATCTGCCAGGCAGAGG + Intergenic
1160221041 18:76978040-76978062 GCTGCTGCTGAGACACGGAGGGG + Intergenic
1160222200 18:76985579-76985601 GGGGCTGCTGAGCCGGACAGAGG + Intronic
1160526986 18:79544042-79544064 GCACCGGCTGGGCCGGGCAGTGG - Intergenic
1160682860 19:419862-419884 GCAGCTCCTGAGTGAGGCTGGGG + Intronic
1160726891 19:621330-621352 GCAGGTGCTGCGCCAGCGAGAGG + Exonic
1160806362 19:993914-993936 GCAGCCACTCAGCCAGGGAGGGG - Intronic
1160857889 19:1225632-1225654 GAAGCTGCTGAGTCAGCCACTGG + Intronic
1160895079 19:1398741-1398763 GCAGCCACTGCGCCAGGCAAAGG + Exonic
1160906252 19:1453028-1453050 GCAGCTGGTGAGGCAGGTGGAGG + Exonic
1161051754 19:2167584-2167606 GAAGATGCTGGGCCCGGCAGTGG - Intronic
1161483791 19:4524037-4524059 GCAGCTCCTGGGTCAGGCTGCGG + Exonic
1161999039 19:7731581-7731603 GCAGCTGGTGCGCCATGCAGTGG + Intronic
1162007128 19:7788036-7788058 GCAGTTGGTGCGCCATGCAGTGG - Intergenic
1162042623 19:7979788-7979810 GCTGCTGCTGAGCCAGGGTTTGG + Intronic
1162301516 19:9847612-9847634 GGAGAGGCTGACCCAGGCAGGGG - Intronic
1162405192 19:10468920-10468942 CCAGCTGCAGAACCAGGCCGAGG - Exonic
1162510345 19:11114173-11114195 GGAGCTGCTGAGTCAGCCATGGG - Intronic
1162531026 19:11236629-11236651 GAAGCTGCTGATTCAGGCAGGGG - Intronic
1162588527 19:11576305-11576327 GTAGCTGCTTGACCAGGCAGTGG + Exonic
1163042652 19:14614102-14614124 GCAGCTGCAGAGGTGGGCAGAGG - Intergenic
1163144270 19:15370061-15370083 CCAGCTTCTGAGCAAGCCAGGGG - Intronic
1163366422 19:16878372-16878394 GCACCTGCTTGGCCCGGCAGAGG - Exonic
1163371300 19:16902745-16902767 TCAGCTGCGGAGGCAGGCATGGG + Exonic
1163433665 19:17282719-17282741 GCTGCTGCTGAGCCAAGGAGCGG + Exonic
1163614456 19:18318435-18318457 GCAGCTGCTAGGAGAGGCAGGGG + Intronic
1163943965 19:20519052-20519074 GGAGCTGCTGAGCCAGGAGAAGG + Intergenic
1164110109 19:22148693-22148715 GGACCTGCTGAGCCAGGCACAGG - Intergenic
1164156850 19:22602383-22602405 CCAGCAGGTGAGCCAGGCACCGG - Intergenic
1164684062 19:30155693-30155715 CGTCCTGCTGAGCCAGGCAGTGG + Intergenic
1164698557 19:30265256-30265278 GCAGCAGCAGAGGCTGGCAGAGG - Intronic
1164708142 19:30335526-30335548 GCAGGTGCTGAGCTACGCGGTGG + Intronic
1164721035 19:30431732-30431754 GCTGCTGCTGCCCCAGGGAGGGG + Intronic
1165160811 19:33814630-33814652 GCAGTGGCTCAGCCAGCCAGGGG + Intronic
1165449975 19:35876582-35876604 GCAGCTCCTGAGCCAGGTGGGGG - Exonic
1165453209 19:35896923-35896945 GCAGCTGCTGGCCCAGGATGAGG - Exonic
1165739819 19:38198466-38198488 CCAGCAGCTGTGTCAGGCAGGGG - Exonic
1165829730 19:38724421-38724443 CCAGCTGCTGCACCTGGCAGAGG - Exonic
1165991540 19:39818065-39818087 GCAGCTCCTGACCCAGTCTGTGG - Intergenic
1166147359 19:40846829-40846851 GGAGATGCAAAGCCAGGCAGAGG - Intronic
1166151508 19:40878714-40878736 GGAGGTGCAAAGCCAGGCAGAGG - Intronic
1166170380 19:41024218-41024240 GGAGCTGCAAAGCCAGGCAGAGG - Intergenic
1166178679 19:41091932-41091954 GCAGGTGCAAAGCCAGGGAGAGG + Intronic
1166179664 19:41098858-41098880 GGACCTGCCGAGCCAGGCATGGG - Intergenic
1166499333 19:43329173-43329195 GGAGCTTCTGAGCCAGGAAAAGG + Intergenic
1166531397 19:43545670-43545692 GAAGGTGCTGAGGCAGGGAGTGG + Intronic
1167096901 19:47379504-47379526 GCAGCCGCTGAGTCAGGGAAGGG - Intronic
1168147866 19:54429794-54429816 GGAGCTGGGGAGCCAGGCACTGG + Intronic
1168670604 19:58238430-58238452 ACAGTGGCTGAGCCAGGCATGGG + Intronic
925192778 2:1898913-1898935 GCAGCTGCCCAGGCAGTCAGGGG + Intronic
925247952 2:2401505-2401527 TCAGCTGCTGAGGCTGCCAGCGG - Intergenic
925669387 2:6294560-6294582 GTAGAGGCTGAGCCAGGCTGGGG - Intergenic
926056856 2:9778812-9778834 GCAGCAGGGAAGCCAGGCAGGGG - Intergenic
926272049 2:11374263-11374285 ACAGCTGCTGAGGCATGCACTGG - Intergenic
926296576 2:11573263-11573285 GCAGCTGCTGAACTAGACACAGG + Intronic
926657006 2:15418870-15418892 GCAGCTGATCAGGAAGGCAGAGG + Intronic
926775969 2:16423643-16423665 GGAGCTGCCCACCCAGGCAGAGG + Intergenic
927013653 2:18932973-18932995 GCAGCTCCGGAGCAATGCAGGGG - Intergenic
927027933 2:19089586-19089608 GGACCTGCTGAGCCAGGCATGGG - Intergenic
927124330 2:19999463-19999485 GCAGAGACTGAGCCAGGGAGAGG - Intronic
927980228 2:27370359-27370381 GCAGCCGCGGAGCGAGGCAGCGG - Intronic
928015994 2:27657602-27657624 GCAGCTCCTCTACCAGGCAGTGG - Exonic
928433564 2:31239453-31239475 GCAGCCCCTAAGCCAGGCCGAGG - Intronic
929428189 2:41865067-41865089 GCAGCTGCTGCCCAGGGCAGCGG - Intergenic
929762984 2:44821291-44821313 GCAGCTCCTCCCCCAGGCAGAGG - Intergenic
929769531 2:44880004-44880026 GCAGCTGGAGCGCCAGGCCGAGG + Intergenic
929804479 2:45132699-45132721 CCAGCAGCTGAGCCAGTGAGGGG + Intergenic
930268981 2:49233456-49233478 GGATTTGCTGAGCCAGGCATGGG + Intergenic
930437050 2:51358246-51358268 GCAGCTGCAGAATCAGGCAGAGG + Intergenic
930908923 2:56606619-56606641 GGACCTGCTGAACCAGGCACGGG + Intergenic
931306553 2:61034657-61034679 GGACCTGCCGAGCCAGGCACAGG - Intronic
931582229 2:63789379-63789401 CCAGGTTCTGAGCCAGGCACTGG - Intronic
931971235 2:67589254-67589276 GGACCCGCTGAGCCAGGTAGGGG - Intergenic
932767679 2:74481823-74481845 GCAACAGCTGAGTCAGGCACTGG - Exonic
932868717 2:75374695-75374717 GGACCTGCTGAGCCAGGCAAGGG + Intergenic
933240719 2:79917726-79917748 GCTGGTGCTGACCCAGGCACAGG + Intronic
933791753 2:85888842-85888864 GCAGCCGCGGACCGAGGCAGCGG - Exonic
934299977 2:91771286-91771308 GAAACTGCTGAGCAGGGCAGGGG + Intergenic
935179080 2:100674272-100674294 GCAACTGCTGGGCCAGCCAAGGG + Intergenic
936820216 2:116510933-116510955 TCAGGTGCTGATCCAGGCAATGG + Intergenic
936909875 2:117579559-117579581 GGACCTACTGAGCCAGGCATGGG - Intergenic
936934104 2:117821660-117821682 GCAGCTGCAAAAACAGGCAGTGG + Exonic
936952414 2:117991511-117991533 GTAGCTGCAGAGCTAGGAAGAGG - Intronic
937304323 2:120861856-120861878 GGAATTGCAGAGCCAGGCAGGGG + Intronic
937309436 2:120893040-120893062 GCAGGAGCTCTGCCAGGCAGGGG - Intronic
937325936 2:120989580-120989602 GCAGCAGCTGCGACAGCCAGTGG + Exonic
937414033 2:121700063-121700085 GCAGGTGCTGAGCAAGGCCGAGG - Intergenic
937606197 2:123804365-123804387 GGACCTGCTGAGCCACGCACAGG + Intergenic
938559393 2:132457926-132457948 GGACCTGCTGAGCCAGGCATGGG + Intronic
938577844 2:132620545-132620567 GGAGCACCTGAGCCACGCAGGGG - Intronic
939055547 2:137360564-137360586 GCACCCACTGAGCCAGGCAAGGG - Intronic
940437308 2:153669870-153669892 GGACCTGCCGAGCCAGGCACAGG - Intergenic
940911300 2:159212347-159212369 GCAGCAGCAGATCCAGGTAGTGG + Intronic
942475153 2:176311696-176311718 GGAGCCACTGAGCCAGGCACGGG + Intronic
942598656 2:177618269-177618291 GCAGCTGCTGAGTGGGGAAGGGG - Exonic
942660275 2:178256568-178256590 GCAGCGTCTGAGGCAGGCTGAGG + Intronic
942744104 2:179212347-179212369 GGACCTGCTGAACCAGGCATAGG - Intronic
943349406 2:186779570-186779592 GCAGTTGCTTAGCCAGCCTGGGG - Intergenic
943716771 2:191160894-191160916 GGACCTGCTGAGCCAGGCATGGG - Intergenic
944396367 2:199272315-199272337 GGAGCTGCTGACCGAGTCAGAGG - Exonic
945161874 2:206900024-206900046 GTACCTGCTGAGCCAGGCATGGG + Intergenic
945716113 2:213359568-213359590 GGACCTGCTGAGCCAGGCACGGG + Intronic
946000370 2:216477105-216477127 ACAGGTGCTGATCCAGGCTGAGG + Exonic
946026612 2:216675486-216675508 GCACCCACCGAGCCAGGCAGAGG - Exonic
946197564 2:218044162-218044184 GCAGCTGCTGTGGCACCCAGGGG + Intronic
946276783 2:218637607-218637629 GTAGCTGCTGAGCCAGTCTGAGG + Intergenic
947194381 2:227546278-227546300 GGACCTGCTGAGCCAGGCGCGGG + Intronic
947493991 2:230619584-230619606 GGACCCGCTGAGCCAGGCATGGG - Intergenic
947829770 2:233130726-233130748 GCATTTGTTCAGCCAGGCAGAGG - Intronic
947875342 2:233464148-233464170 CCAGCTGCTGCTCCAGGCGGAGG - Exonic
947902867 2:233737350-233737372 GGAGCTGCTAAGCCAGGCAGGGG + Intronic
948205876 2:236162646-236162668 GCAGCCACCGACCCAGGCAGAGG - Intergenic
948383964 2:237570160-237570182 GCAGCAGCTGAGCCTGGCATGGG - Intergenic
948399190 2:237670760-237670782 GCAGAAACTGAGGCAGGCAGGGG - Intronic
948401593 2:237689604-237689626 ACAGCTGTTGTGGCAGGCAGTGG + Intronic
948883665 2:240872695-240872717 CCAGCTGCAGGGCCCGGCAGTGG - Intronic
1168795920 20:610162-610184 GCGGCTGCTGAGCGAGGACGAGG - Exonic
1168854124 20:997040-997062 ACAGCTGCTGAGCCAGGACCTGG - Intronic
1168907558 20:1418176-1418198 GGAGCTGAGGAGCCAGGGAGGGG + Intergenic
1168963683 20:1886120-1886142 GCAGCTGGGCAGCCAGGCAACGG - Intergenic
1169230965 20:3888869-3888891 GCAGCTGCGGAACTAGGCCGAGG + Intronic
1169861684 20:10159386-10159408 GGACCTGCCGAGCCAGGCACGGG - Intergenic
1170186174 20:13593551-13593573 GGACCTGCCGAGCCAGGCATGGG - Intronic
1170347874 20:15407078-15407100 GCAGGTGCTGCGCATGGCAGGGG - Intronic
1171094267 20:22316533-22316555 GGACAAGCTGAGCCAGGCAGGGG - Intergenic
1171128181 20:22623167-22623189 ACAGCTGCTGAGCCCTTCAGAGG - Intergenic
1172118227 20:32583949-32583971 GCTGCTCCTGCGCCAGGCTGCGG + Intronic
1173317768 20:41960400-41960422 ACAGCTGTTGAGCGAGGCTGGGG + Intergenic
1173543864 20:43876923-43876945 GCACCCTCTGAGCCAGGCATGGG + Intergenic
1173627128 20:44481259-44481281 TGAGCTGCTGCGCCTGGCAGGGG - Intronic
1173810358 20:45951642-45951664 GCAGCTGCTGTGACAGGAAGTGG + Intronic
1173871013 20:46342194-46342216 CCAGCTGCTTTGCCAGGCAGAGG - Intergenic
1174070319 20:47895057-47895079 GGAGCTGCAGACCCAGGGAGGGG + Intergenic
1174224085 20:48982789-48982811 GGACCTGCTGAGCCAGGCACAGG + Intronic
1175244495 20:57573364-57573386 GCAGCTGCTGAGTGAGTCACCGG - Intergenic
1175829067 20:61952196-61952218 CTCGCTGCTGAGCCAGGCAGGGG + Intergenic
1176172386 20:63701797-63701819 GAAGCTGCTGCGGGAGGCAGGGG + Intronic
1176177045 20:63733624-63733646 GCTGCTGCTGAGGGAGGCCGTGG + Exonic
1176376923 21:6091452-6091474 GGTGCTGCTGGGCCGGGCAGTGG + Intergenic
1176421420 21:6519186-6519208 CCAGCTACTGAGGCAGGCTGAGG + Intergenic
1177651950 21:23968883-23968905 GTAGCTGCTGAGGAAGGGAGGGG + Intergenic
1178488064 21:33031245-33031267 GGTGCTGCAGAGCCACGCAGTGG - Intergenic
1178667823 21:34564345-34564367 GAAGCTGGAGAGGCAGGCAGGGG + Intronic
1178973562 21:37202366-37202388 GAAGCTGCTAAGGAAGGCAGCGG - Exonic
1179154584 21:38838864-38838886 GGAGCTGCTGACCCACACAGGGG - Intergenic
1179696910 21:43127501-43127523 CCAGCTACTGAGGCAGGCTGAGG + Intergenic
1179746552 21:43446792-43446814 GGTGCTGCTGGGCCGGGCAGTGG - Intergenic
1181051188 22:20239029-20239051 TCAGGTGCTGGACCAGGCAGGGG - Intergenic
1181326966 22:22057393-22057415 GGACCTGCTGAGCCAGGCAACGG + Intergenic
1181636018 22:24175276-24175298 GCGACTGCTGGGCTAGGCAGAGG - Intronic
1181891658 22:26068734-26068756 GGAGCCGCTGGGCCTGGCAGAGG + Intergenic
1182057758 22:27373375-27373397 GGACCCGCTGAGCCAGGCATGGG - Intergenic
1182080702 22:27526825-27526847 CCAGCTGGTGAGGCAGGCAGGGG + Intergenic
1182831123 22:33305308-33305330 AGAGATGCTGAGCCAGGGAGAGG + Intronic
1183055355 22:35301757-35301779 GAAGCTCCTGAACCAGGGAGAGG + Intronic
1183213242 22:36463861-36463883 GCAGCTGGTGTTCCAGGCATCGG + Intergenic
1183542223 22:38436039-38436061 GAAGCTGCTGCACCAGGCGGGGG - Intronic
1183984220 22:41560751-41560773 GCAGCTGCTGAGGAATGCAGGGG - Exonic
1184157871 22:42680508-42680530 TGTGCTGCTGAGCCAGGCTGGGG - Intergenic
1184549607 22:45197458-45197480 GCAGCAGCTGTGACAGGCAGTGG - Intronic
1184675599 22:46041021-46041043 GAATCTGCTCAGCCAGGGAGGGG - Intergenic
1184939037 22:47747380-47747402 GCAGCTGCTGCGGCCTGCAGAGG - Intergenic
1185065776 22:48631085-48631107 GGACCTCCTGGGCCAGGCAGAGG + Intronic
1185139058 22:49090134-49090156 GCAGGAGCTGAGCCGGGAAGGGG + Intergenic
1185196488 22:49473638-49473660 GCAGGTGCAGGGCCCGGCAGGGG - Intronic
1185312761 22:50165746-50165768 CCAGATGCTGCCCCAGGCAGGGG + Intergenic
1185340171 22:50287576-50287598 GGAGCTGTTGGGACAGGCAGGGG - Intronic
1185371582 22:50463366-50463388 GCAGCTCCTGGGCGAGGCAGCGG + Exonic
949189372 3:1233314-1233336 GAAGATGGTGAGCTAGGCAGGGG + Intronic
949450021 3:4174883-4174905 GGAGCTGCCGAGCCAGGCACAGG - Intronic
949579830 3:5376855-5376877 GGACCCACTGAGCCAGGCAGTGG - Intergenic
949803995 3:7934510-7934532 GCATCTGCTGAGCCAGGCACGGG - Intergenic
949825070 3:8156594-8156616 GGAGATGCTGAGTGAGGCAGAGG - Intergenic
950180501 3:10909706-10909728 GCAGCTGCTGACCCAGGAAATGG - Intronic
950481114 3:13244654-13244676 CCAGCTGCTGAGGCTGGGAGTGG - Intergenic
951006229 3:17618695-17618717 GGACCTGCTGAGCCAGGAATGGG + Intronic
951183193 3:19682605-19682627 GGACCTGCTGAGCCAGGCACTGG + Intergenic
953033487 3:39192596-39192618 GCAGCTGCTGGGGCTGGCAGGGG - Intronic
953980708 3:47411591-47411613 TCAGCAGCTGTGCCAGGCAGTGG - Exonic
954690383 3:52392476-52392498 CCAGCTACTGGGCCAGGTAGTGG + Exonic
954695360 3:52421772-52421794 GCAGGAACTGAGCCAGGGAGTGG + Intronic
955464914 3:59226646-59226668 GGAGCCACTGAGCCAGGCACAGG + Intergenic
955860959 3:63329866-63329888 GCAGCTGCTAGGCCAAGCAAAGG - Intronic
956048351 3:65220522-65220544 GGACCTGCTGAGCCAGGCGTGGG + Intergenic
956373256 3:68586937-68586959 GGACCTGCTGAGCTAGGCACGGG + Intergenic
956695658 3:71917087-71917109 GTAGCTGGTGAGCCAGGATGGGG + Intergenic
956893087 3:73631790-73631812 CCAACTCCTGAGCCAGGGAGTGG + Intergenic
956994937 3:74815315-74815337 CCAGCTGCTGTGCTAGGCATTGG - Intergenic
957951210 3:87129467-87129489 GCAGCTTCTGACCCAGGAATTGG - Intergenic
958124405 3:89336932-89336954 GCACCTGTTGACCCAGGCTGAGG + Intronic
958421663 3:93938201-93938223 GGAGCTGCTGAGCCAGGAGAAGG - Intronic
958826282 3:99035126-99035148 GAACCCTCTGAGCCAGGCAGGGG - Intergenic
958873476 3:99589194-99589216 GGACCTGTTGAGCCAGGCATGGG - Intergenic
958957832 3:100480364-100480386 GGACCTGCTAAGCCAGGCACTGG + Intergenic
959045289 3:101467033-101467055 GGACCTGCCGAGCCAGGCACGGG - Intronic
959162226 3:102736827-102736849 GCAGCTGCTGATGAAGGGAGGGG - Intergenic
959290711 3:104469635-104469657 GGACCTGCTGAGCCAGGCACAGG + Intergenic
959692911 3:109218918-109218940 GGACCTGCTGAGCCAGGCGTGGG - Intergenic
960041209 3:113151598-113151620 GCCCCTGCTGAGCCAGGCTGGGG + Intergenic
960065388 3:113366910-113366932 GGACCCGCTGAGCCAGGCATGGG - Intronic
960534546 3:118802215-118802237 GCAGCTGCTGACGAAGGGAGGGG + Intergenic
960697189 3:120407650-120407672 GCAGCTGCTGACCTAGGAGGAGG + Intronic
960784414 3:121356484-121356506 GGACCTGCTGAACCAGGCACAGG + Intronic
960890514 3:122443153-122443175 GGACCCGCTGAGCCAGGCATGGG - Intronic
960989037 3:123298679-123298701 CCAGCCACTGAGCTAGGCAGTGG - Intronic
961439895 3:126946432-126946454 GCTGCTGCTTAGTGAGGCAGAGG - Intronic
961570336 3:127793196-127793218 GGAGCTGCTGAGCCAGCCAAGGG - Intronic
961644670 3:128386460-128386482 GTATCAGCTGAGACAGGCAGTGG + Intronic
961830873 3:129622444-129622466 GCACCTGCTGAGCTAGGAGGTGG - Intergenic
962319219 3:134377034-134377056 GCAGCTGCAGGGCCAGACTGAGG - Intergenic
962426290 3:135271783-135271805 ACAGCTGCACAGCCAGGAAGGGG + Intergenic
962513476 3:136126320-136126342 GGACCTGCCGAGCCAGGCACGGG - Intronic
962624460 3:137211351-137211373 GCACCCACTGAGCCAGGCACAGG - Intergenic
962675176 3:137751021-137751043 GGACCTGCTGAGCCAGGCACAGG - Intergenic
962748160 3:138412992-138413014 GCTGCTGTTGAGTCATGCAGAGG - Intergenic
962892587 3:139685547-139685569 GGAGCTGAAGAACCAGGCAGGGG - Intergenic
962921515 3:139954425-139954447 GCAGGCACTGAGCCTGGCAGTGG + Intronic
962948715 3:140198471-140198493 ACAGCTGGTGAGCCTGGCAGAGG - Intronic
963214339 3:142727523-142727545 GCAACTGCTGATCTAGGTAGTGG + Intronic
965289825 3:166865087-166865109 GCAGCTGCCCTGCCAGGCTGCGG + Intergenic
966203856 3:177385953-177385975 ACAGCTCCTGAGCTAGGCACTGG + Intergenic
966269196 3:178084191-178084213 CCATCTGTTTAGCCAGGCAGTGG - Intergenic
966583160 3:181591213-181591235 GCAGCCACAGAGCCAGGCACAGG + Intergenic
966942768 3:184757458-184757480 TTGGCTGCTGAGCCAGACAGGGG - Intergenic
967199305 3:187058088-187058110 GGACCCGCTGAGCCAGGCACAGG + Intronic
968047628 3:195632778-195632800 GCAGAGGCAGAGCCAGGGAGAGG + Intergenic
968306985 3:197657146-197657168 GCAGAGGCAGAGCCAGGCAGAGG - Intergenic
968361668 3:198151690-198151712 GCAGCTGCTGAGAACGGCTGTGG - Intergenic
968860659 4:3166732-3166754 GGACCCGCTGAGCCAGGCACAGG + Intronic
968890668 4:3366944-3366966 GGAGGAGCTGAGCCGGGCAGAGG - Intronic
969331287 4:6474628-6474650 TCAGCTTCTGAGCCATGCTGGGG + Intronic
969474205 4:7412071-7412093 GCAGCTGCTGGCCCAGGAGGTGG + Intronic
969535840 4:7755660-7755682 GCTCCTGCTGAGCCATGCAGGGG - Intergenic
969659293 4:8517220-8517242 GCAGCTGTTGGACCAGACAGAGG + Intergenic
969868637 4:10091593-10091615 GCAGCTGCTCAGCAAGCCTGGGG + Intronic
971437238 4:26640756-26640778 GGACCTGCTGAGCCAGGCATGGG - Intronic
973312948 4:48729071-48729093 GGACCTGCTGAGCCAGGCACGGG - Intronic
973598977 4:52522198-52522220 GCAGCCACCGAGCCAGGCATGGG - Intergenic
974196788 4:58585406-58585428 GGACCTGATGAGCCAGGCACTGG + Intergenic
974360178 4:60867567-60867589 GCAGATGCTGATCCAGTGAGGGG + Intergenic
975203255 4:71616115-71616137 GGAGACGCTGAGCCAGGCATGGG - Intergenic
975219458 4:71797483-71797505 GGACCTGCCGAGCCAGGCAGGGG + Intronic
975500562 4:75080045-75080067 GGAGCTGCCAAGCCAGGCATGGG + Intergenic
975727172 4:77303381-77303403 GGACCTGCTGAGCCAGGCATGGG + Intronic
975753591 4:77550135-77550157 GGATCTGCTGAGCCAGGCACAGG + Intronic
975915944 4:79325607-79325629 TCAGCTTCTGGGCCAGGCCGAGG + Exonic
976204482 4:82611496-82611518 GCAGCAGCTGAGCCACACAAAGG - Intergenic
976337404 4:83906223-83906245 GCAGCTGCTGCTGCTGGCAGTGG + Intergenic
976347713 4:84024600-84024622 ACAGCTGCGAAGCCAGGCAGTGG + Intergenic
976580526 4:86730600-86730622 GGACCTGCTGAGCCAGGAACGGG + Intronic
976693419 4:87893184-87893206 GCAGCAGCTCAGACAGGCGGTGG - Intergenic
977179670 4:93857840-93857862 GCAGCTGCTCAGCCAGCCTGGGG - Intergenic
977294295 4:95193817-95193839 CAGACTGCTGAGCCAGGCAGTGG + Intronic
977446719 4:97139891-97139913 GCAGCTTCTGAGCCAGGAGAAGG + Intergenic
977771722 4:100868597-100868619 GGACCTGCCGAGCCAGGCACGGG + Intronic
977946464 4:102919756-102919778 GGACCCGCTGAGCCAGGCACGGG - Intronic
978552171 4:109939333-109939355 GGACCAGCTGAGCCAGGCAGGGG + Intronic
979315390 4:119255542-119255564 GGACCCGCTGAGCCAGGCACGGG + Intronic
979516575 4:121616548-121616570 GGACCTGCCGAGCCAGGCACGGG - Intergenic
980558738 4:134442941-134442963 GGACCTGCTGAGCCAGGCACAGG + Intergenic
980803557 4:137783985-137784007 GGACCTGCTGAGCCAGGCACGGG - Intergenic
981442583 4:144799653-144799675 GCAGCTGGTGAGCAAGGCTGAGG + Intergenic
981796305 4:148599091-148599113 GGACCCGCTGAGCCAGGCATGGG + Intergenic
982337951 4:154260691-154260713 GCAGCTGCTGGGAAATGCAGAGG - Intronic
983594301 4:169449005-169449027 GGACCTGCCGAGCCAGGCACAGG - Intronic
983949097 4:173619029-173619051 GGACCTGCCGAGCCAGGCATGGG + Intergenic
984434040 4:179685469-179685491 GGACCTGCTGAGCCAGGCATGGG + Intergenic
984961488 4:185102052-185102074 GCTGCTGCGGAGCCAGGAAATGG - Intergenic
985367370 4:189245815-189245837 GGACCTGCCGAGCCAGGCACGGG + Intergenic
985534909 5:458926-458948 CCAGGAGCTGACCCAGGCAGAGG - Intronic
985706137 5:1402387-1402409 GCAGCTGGAGCCCCAGGCAGTGG - Intronic
985714565 5:1448140-1448162 GCAGCTGCGGTCCCAGCCAGTGG - Intergenic
985743986 5:1636386-1636408 GCAGAGGCAGAGCCAGGGAGAGG - Intergenic
985771747 5:1816170-1816192 GCAGCCGGTAAGGCAGGCAGCGG - Exonic
985975740 5:3417943-3417965 GCAGCAGCTGAGCGTGGAAGGGG - Intergenic
986008737 5:3692443-3692465 TCAGCTGCAGAGCCAGGACGTGG - Intergenic
986368005 5:7054511-7054533 TCACCTGAAGAGCCAGGCAGGGG + Intergenic
987173925 5:15287400-15287422 GCAGCTGCAGCACCAAGCAGGGG - Intergenic
987173952 5:15287686-15287708 GGAGCTGCTGCACCAAGCAGGGG + Intergenic
987179894 5:15356416-15356438 GGACCCGCTGAGCCAGGCACAGG - Intergenic
987444979 5:18006339-18006361 GGACATGCTGAGCCAGGCACGGG - Intergenic
988466770 5:31499107-31499129 TCAGGTACTGAGCAAGGCAGAGG + Intronic
988671744 5:33389007-33389029 GGAGCTGCTGAGCCAGGCATGGG - Intergenic
988859401 5:35261734-35261756 GGACCCTCTGAGCCAGGCAGCGG + Intergenic
989302180 5:39907636-39907658 GAAGCTTCCGAGCCAGGCACAGG - Intergenic
989390521 5:40895697-40895719 GGACCGGCTGAGCCAGGCACGGG - Intergenic
989522473 5:42418216-42418238 GGACCTGCTGAGCCAGGCACAGG + Intergenic
989552031 5:42746473-42746495 TCAGCTGCTGAGCTAGGAAGTGG - Intergenic
989671151 5:43918222-43918244 GGACCTGCTGAGCCAGGCACGGG + Intergenic
990230309 5:53705982-53706004 GGACCCGCTGAGCCAGGCATGGG + Intergenic
990244888 5:53854491-53854513 GGACCTGCTGAGCCAGGCACGGG + Intergenic
990715264 5:58629331-58629353 GCAGCTGGAGAGCCAGGCAGGGG + Intronic
990869984 5:60420884-60420906 GGACCTGCTAAGCCAGGCACAGG - Intronic
990898915 5:60729169-60729191 GGACCTGCTGAGCCAGGCACGGG - Intergenic
991106643 5:62851389-62851411 GCAGCAGCTGTGGCAGGCAAGGG + Intergenic
991535616 5:67666618-67666640 GGACCTTCTGAGCCAGGCACGGG + Intergenic
991575839 5:68102552-68102574 GGACCTGCTGAGCCAGGCACGGG - Intergenic
992580940 5:78175014-78175036 GGACCTGCTGAGCCAGGCATGGG + Intronic
992756470 5:79911319-79911341 GGACCTGCTGAGCCAGGCACGGG - Intergenic
993285714 5:85992844-85992866 GCAGCTGCGGAGTCAAGCACAGG - Intergenic
993366726 5:87042816-87042838 GGACCTGCCGAGCCAGGCACAGG + Intergenic
993405349 5:87505207-87505229 GCAGCTGCTGACTCAGGAAATGG - Intergenic
993438311 5:87924772-87924794 GGACCTGCTGAGCCAGACACGGG + Intergenic
994586535 5:101716070-101716092 GGAGCCACTGAGCCAGGCACGGG + Intergenic
994639230 5:102386130-102386152 CCATCTGCTGACCCAGGCACTGG - Intronic
995052748 5:107724835-107724857 GCAGCAGCTGAGCGAGCCCGAGG + Intergenic
995489840 5:112679293-112679315 GCTCCTGCTGAGCCAGGCACGGG + Intergenic
996819302 5:127608423-127608445 GAAGCTGCTGAGACAGGTAAGGG - Intergenic
996900545 5:128538155-128538177 GCGGCTGCGGAGCCGGGCGGAGG + Intronic
997004627 5:129803661-129803683 GGACCCGCTGAGCCAGGCACTGG + Intergenic
997343902 5:133171021-133171043 GGAGCTACTGAGCCAGGCACGGG + Intergenic
997497037 5:134337143-134337165 GGACCTGCTGAGCCAGGCACGGG + Intronic
998017595 5:138744972-138744994 GGAGCTGCTGAGGTAGGTAGAGG - Intronic
998044112 5:138972480-138972502 GCAGCAGCAGAGCCAGCCTGAGG - Intronic
998182616 5:139956023-139956045 GCAGATGCTGAGACAGGCAGAGG + Intronic
998895015 5:146789888-146789910 GCAGATGGTCAGGCAGGCAGGGG + Intronic
999129336 5:149271374-149271396 GCACCTTCTAAGCCAGACAGTGG - Intergenic
999273325 5:150311430-150311452 GCTGGAGCTGAGGCAGGCAGTGG + Intronic
999773335 5:154791948-154791970 GAAGCTGCTGAGACTTGCAGAGG + Intronic
1000574761 5:162964482-162964504 GGACCTGCCGAGCCAGGCACGGG + Intergenic
1001084845 5:168693088-168693110 GCAGGTACTGTGCCAGGCACTGG + Intronic
1001086391 5:168702885-168702907 GCAGGGGCTAACCCAGGCAGGGG - Intronic
1001297425 5:170508057-170508079 GCAGCTGCTGGGCTTGTCAGCGG + Intronic
1001333700 5:170780904-170780926 GGAGTTGCTGAGCCAGGCGTTGG + Intronic
1001920644 5:175596806-175596828 GCAGCTGTGGGGCCAGGGAGGGG - Intergenic
1002184585 5:177448090-177448112 GCATCTGCTGAGTCAGGCCTGGG - Intronic
1002443183 5:179274796-179274818 GAAGCTGATGTGCCAGGCAGGGG + Intronic
1002690031 5:181044216-181044238 AAAGCTGCTGGGCCATGCAGAGG - Intronic
1002742691 5:181444995-181445017 ACAGCTGCAGAGGGAGGCAGGGG + Intergenic
1003330659 6:5125615-5125637 CCTGCAGCTGAGCCTGGCAGAGG + Intronic
1003434414 6:6072536-6072558 GGACCTGCTGAGCCAGGCACAGG + Intergenic
1003535284 6:6970762-6970784 GGAGATGCTGAGACAGGCATGGG + Intergenic
1004024504 6:11805768-11805790 GCAGCGGCAGCCCCAGGCAGAGG - Intronic
1004216764 6:13711216-13711238 GCAGCCGCTGAGGCAGGGGGAGG + Exonic
1004263514 6:14129332-14129354 GAAGCCGCTCTGCCAGGCAGCGG + Intronic
1004616218 6:17292077-17292099 GCAGCTGCTGAGGCTGGTACTGG - Exonic
1004731582 6:18364742-18364764 GCAGCTGCAAAAACAGGCAGTGG - Intergenic
1004903274 6:20212665-20212687 CCAGCTGCAGGGCCAGGCGGCGG - Intergenic
1007112754 6:39322514-39322536 GCAGCTGCAGAGCCCAGCACTGG + Exonic
1007607255 6:43125927-43125949 GCAGAAGCTGAGCGAGGAAGTGG + Intronic
1007655725 6:43450022-43450044 GCAGCTGCTGGAACAGGGAGTGG - Exonic
1007666665 6:43517439-43517461 GCAGCTTCTGAGACAGACACAGG - Intronic
1007780593 6:44251766-44251788 GCAGCAGCTCAGACAGGCGGCGG - Exonic
1008633152 6:53383051-53383073 GGAACTGCTGAGCCAGGCATAGG - Intergenic
1009393255 6:63167306-63167328 GGAGCCACTGAGCCAGGCATGGG - Intergenic
1009652039 6:66489259-66489281 GGACCTACTGAGCCAGGCACTGG - Intergenic
1010298031 6:74223105-74223127 GGACCTGCTGAGCCAGGCACGGG + Intergenic
1010422151 6:75688189-75688211 GGAGCCGCCGAGCCAGGCACGGG + Intronic
1010676965 6:78756448-78756470 GGACCTGTTGAGCCAGGCATGGG - Intergenic
1010973150 6:82284307-82284329 GGACCAGCTGAGCCAGGCACGGG + Intergenic
1011209157 6:84936250-84936272 GAACCTGCTGAGCCAGGCACTGG - Intergenic
1011956662 6:93032359-93032381 GGACCTTCTGAGCCAGGCATGGG - Intergenic
1012597989 6:101062328-101062350 GGACCTGCTGAGCCAGGCTTAGG - Intergenic
1012881816 6:104800059-104800081 GGACCCGCTGAGCCAGGCACGGG - Intronic
1013741941 6:113297668-113297690 GAAGCTGGGGAGCCAGGCAAAGG - Intergenic
1014013289 6:116501195-116501217 GGACCTGCTGAGCCAGTCACAGG - Intronic
1014063609 6:117101057-117101079 GGACCTTCTGAGCCAGGCATGGG + Intergenic
1014924565 6:127255384-127255406 GGACCCGCTGAGCCAGGCATGGG - Intergenic
1015732272 6:136361052-136361074 GCAGCTGCAGCGGCAGGCGGAGG - Exonic
1015820821 6:137258684-137258706 GCTGCTGCTGGGGCTGGCAGTGG + Intergenic
1016655652 6:146515480-146515502 GGACCTGCTGAGCCAGGCACAGG + Intergenic
1016856039 6:148671509-148671531 GGACCTGCTGAGCCAGGCCCCGG + Intergenic
1017049331 6:150375764-150375786 GCAGATGCTGAGCCCTGAAGTGG + Intronic
1017302880 6:152882999-152883021 GGACCTGCTGAGCCATGCACGGG - Intergenic
1017985163 6:159437102-159437124 GCAGCTGGGGAGCCGGGCAGTGG + Intergenic
1018015034 6:159704480-159704502 GCACCCTCTGAGCCAGGCACAGG - Intronic
1018851523 6:167643943-167643965 GGAGCTGCTGTGGCAGGGAGAGG - Intergenic
1018946324 6:168348809-168348831 GCAGCACCTGAGGCTGGCAGCGG - Intergenic
1019154290 6:170028923-170028945 CCAGCAGCGGAGCCAGGCAATGG + Intergenic
1019217216 6:170451703-170451725 GCTGCTGCTGCTCCAGGCAAGGG - Intergenic
1019247826 6:170720734-170720756 ACAGCTGCAGAGGGAGGCAGGGG + Intergenic
1019254016 7:37032-37054 GCAGCTGCTGAGAACGGCTGTGG + Intergenic
1019381632 7:727158-727180 GCAGCTGCTGGGCCTGGCCGTGG + Exonic
1019512712 7:1426046-1426068 GCTGCGGCTGAGCCAGGCAGGGG - Intergenic
1019594656 7:1852858-1852880 GCACGTGCTGAGCCTGGAAGGGG + Intronic
1019738281 7:2660980-2661002 CCAGCTGCAGAGCCAGGCACAGG + Intronic
1019925899 7:4191641-4191663 TCAGCTGCTCCGCCAGGGAGAGG + Intronic
1020040643 7:4998320-4998342 GGAGCTGGTGAGCCAGCCTGGGG + Intronic
1020809979 7:12839832-12839854 GGACCTGCTAAGCCAGGCACAGG - Intergenic
1020915487 7:14187268-14187290 CCAGATGTTGGGCCAGGCAGAGG - Intronic
1021755212 7:23844871-23844893 GGACCTGCCGAGCCAGGCATGGG - Intergenic
1022090774 7:27106753-27106775 GCTGCTGCGGAGGCAGGCTGAGG - Exonic
1022099224 7:27159327-27159349 GCAGCTGGTGAGAGAGGCAAGGG - Intergenic
1022329326 7:29362592-29362614 GTGGCTGCTGAGCCAGGGCGTGG - Intronic
1022477378 7:30720360-30720382 GGAGCTGCTCACCTAGGCAGAGG + Intronic
1022563513 7:31373892-31373914 GGGGCTGCTGAGCACGGCAGAGG + Intergenic
1023034702 7:36120263-36120285 GGACCTGCTGAGCCAGGCATAGG - Intergenic
1023050390 7:36246144-36246166 GCAGCTTCTCAGGCAGGCACTGG - Intronic
1023066063 7:36378893-36378915 GGACCTGCTGAGCCAGGCATGGG + Intronic
1023221987 7:37928982-37929004 GCAGATCCTGAGCCAAGAAGTGG - Intronic
1023310973 7:38886349-38886371 GTACCTGCCGAGCCAGGCACGGG - Intronic
1023453735 7:40315631-40315653 ACAGCTGCTGTGCTAGGTAGGGG + Intronic
1023779826 7:43645337-43645359 GCAGCTGCAGAGCCATCCCGAGG - Exonic
1024023606 7:45392165-45392187 GCAGCTGCTGAGCCAGGCAGTGG - Intergenic
1024216685 7:47254472-47254494 AGAGCTGCTGAGCCAGGCTCAGG + Intergenic
1024591272 7:50887176-50887198 GGACCTGCCGAGCCAGGCATGGG - Intergenic
1024676699 7:51644119-51644141 GGAGCCCCTGAGCCAGGCACAGG - Intergenic
1025213305 7:57033747-57033769 GCAGGTCCTGTGCCAGGCACTGG - Intergenic
1025658648 7:63543077-63543099 GCAGGTCCTGTGCCAGGCACTGG + Intergenic
1026845520 7:73696998-73697020 GCAGCTGCAGAGCAGGGCTGGGG - Intronic
1026848129 7:73708932-73708954 GGAGCTGCTGAGCCAGGTGCAGG + Intronic
1027054715 7:75042304-75042326 TCAGCTGCAGTGCCAGGCGGAGG - Exonic
1027980269 7:85210143-85210165 GCATCTGCTGAGAGAGGCTGTGG - Intergenic
1028078748 7:86548069-86548091 GGACCCGCTGAGCCAGGCACAGG + Intergenic
1028396038 7:90369612-90369634 GGACCTGCTCAGCCAGGCACGGG + Intronic
1028413022 7:90551324-90551346 GGACCTGCTGTGCCAGGCAAGGG + Intronic
1028544821 7:91986190-91986212 GGACCTGCTGAGCCAGGCACGGG + Intronic
1028891506 7:95992890-95992912 GCAGTGGCTGAGGCCGGCAGAGG - Intronic
1029017572 7:97330068-97330090 GGACCTGCCGAGCCAGGCACAGG - Intergenic
1029062268 7:97810690-97810712 GGACCTGCTGAGCCAGGTATGGG - Intergenic
1029218487 7:98969645-98969667 CCAACTGCAGAGGCAGGCAGGGG + Intronic
1029815823 7:103093719-103093741 GCAGCTGCAGAGTCAGGCAGAGG - Intronic
1029951971 7:104595855-104595877 GGCACTGCTGAGCCAGGCATGGG + Intronic
1030202469 7:106919128-106919150 GGACCCGCTGAGCCAGGCATGGG - Intergenic
1030611729 7:111697366-111697388 GGAGCTGCTGTGCCTGGCTGAGG + Intergenic
1031699036 7:124900852-124900874 GGACCTGATGAGCCAGGCATGGG - Intronic
1031741748 7:125441343-125441365 GCAGCTACTGAGACAAGAAGGGG + Intergenic
1033055240 7:138046702-138046724 GCAGCTGCTCACCACGGCAGTGG - Intronic
1033128727 7:138727133-138727155 AAAAATGCTGAGCCAGGCAGGGG + Intronic
1033210808 7:139458934-139458956 GCAGGTGCTGAGGCAGGGTGGGG - Intronic
1034282038 7:149861326-149861348 GCAGCCGGTGGGCCACGCAGTGG - Exonic
1034386667 7:150746115-150746137 CCATCTGCTGAACCAAGCAGGGG - Intronic
1034399830 7:150854894-150854916 GAAGAGGCTGGGCCAGGCAGAGG + Intronic
1034422400 7:150996496-150996518 GCAGCTGCTGAGTCAGGCCCGGG + Exonic
1034487283 7:151373879-151373901 GCTGCTTCTGAGGCAGGCAGTGG - Intronic
1034498755 7:151436930-151436952 CCGGCTTCTGAGCCAGGCAGGGG - Intronic
1034928834 7:155144332-155144354 GCAGCTGTTGAGAAAGCCAGGGG - Intergenic
1035062995 7:156082829-156082851 GCTCCTGCTGCGCCAGGGAGTGG - Intergenic
1035175265 7:157045669-157045691 GCTGCTGCTGTGCCCGGCACAGG + Intergenic
1035223821 7:157422650-157422672 GCCGCTGCATAGCAAGGCAGCGG - Intergenic
1035477606 7:159154429-159154451 GGCACGGCTGAGCCAGGCAGCGG - Intergenic
1035500291 8:87130-87152 ACAGCTGCAGAGGGAGGCAGGGG - Intergenic
1035533287 8:372358-372380 GGAGCCTCTGAGCCAGGCACGGG + Intergenic
1035619179 8:1024517-1024539 CAAGCTGCTGTGCCAGGCAGAGG - Intergenic
1036747488 8:11420243-11420265 GCAGCTGCAGAGGCTGGCGGGGG - Intronic
1037447279 8:18978675-18978697 TGAGCTGCGGAGCCTGGCAGTGG - Intronic
1037487789 8:19364604-19364626 GCAGCCGGTGAGCCAGTGAGGGG + Intronic
1037584167 8:20265072-20265094 GCAGCTGCTGTCCCAGGTCGGGG + Intronic
1037603371 8:20417601-20417623 GCAGCAGCTGTGTCTGGCAGGGG + Intergenic
1037702188 8:21285225-21285247 ACAGCTGCTGTCCCAGGCATAGG + Intergenic
1038359892 8:26865772-26865794 GAAGCTGCTTCGCCCGGCAGCGG + Intronic
1039154076 8:34535724-34535746 GGACCTGCTGAGCCAGGCACGGG - Intergenic
1039580122 8:38658816-38658838 GCAGCTGCTGATCCCAGCTGGGG - Intergenic
1039680950 8:39735680-39735702 GGACCTGCCGAGCCAGGCATGGG - Intergenic
1039832371 8:41225326-41225348 GGACCTGCCGAGCCAGGCACGGG - Intergenic
1039971372 8:42324221-42324243 GAAGCTGCTGAGGTAGGCAAGGG + Intronic
1040106719 8:43545926-43545948 GCAGGTGCTGCGCCAGACAGGGG - Intergenic
1040294816 8:46143709-46143731 GGGGCTGTTGAGTCAGGCAGAGG - Intergenic
1040298758 8:46177049-46177071 GGAACTGTTGAGGCAGGCAGAGG + Intergenic
1040311085 8:46237205-46237227 GGGGCTGTTGAGGCAGGCAGAGG + Intergenic
1040316300 8:46262683-46262705 GGGGATGCTGAGGCAGGCAGAGG + Intergenic
1040318191 8:46275982-46276004 GGAGATGTTGAGGCAGGCAGAGG - Intergenic
1040323836 8:46331302-46331324 GGAGATGTTGAGGCAGGCAGAGG + Intergenic
1040333341 8:46403547-46403569 GGAGATGTTGAGGCAGGCAGAGG + Intergenic
1040338445 8:46427896-46427918 GCAGACGTTGAGGCAGGCAGAGG + Intergenic
1040480391 8:47820886-47820908 GAAGCTGCTGCTCCAGGGAGAGG - Exonic
1040556693 8:48485887-48485909 GGACATGCTGAGCCAGGCATGGG - Intergenic
1040607264 8:48946452-48946474 GCACCCACTGAGCCAGGCACGGG + Intergenic
1041004288 8:53484103-53484125 GCAGCTGCTGACGAAGGGAGGGG - Intergenic
1043165851 8:76901889-76901911 GGATCGGCTGAGCCAGGCACAGG + Intergenic
1043965685 8:86472441-86472463 GCAGCTGAAGGGCCAGGAAGTGG - Exonic
1044073746 8:87793464-87793486 GCAGCTGCTGAGCCAGGCACAGG - Intergenic
1044292747 8:90491826-90491848 GGACCTGCTAAGCCAGGCACAGG + Intergenic
1044521606 8:93205520-93205542 GGACCTGCTGAGCCAGGCATGGG + Intergenic
1045599153 8:103693703-103693725 ACACCTGCTGACCCAGGCACTGG - Intronic
1047537214 8:125730598-125730620 GCAGCTCCAGTGCCAGGCAGTGG - Intergenic
1047684403 8:127289983-127290005 GCTGCTACTGAGCCTGGCTGAGG + Intergenic
1048181124 8:132195401-132195423 GACGCAGCTGAGCCAGGCAATGG + Intronic
1048641556 8:136369096-136369118 ACAGATGCTGAGCCAGGCCCTGG - Intergenic
1048664856 8:136649603-136649625 ACAGTTGCTGAGGCAGTCAGTGG - Intergenic
1048768461 8:137869120-137869142 GCAGCTGATGAACCAGGAACAGG + Intergenic
1049257000 8:141619501-141619523 GGAGCCTCTGAGCCTGGCAGAGG - Intergenic
1049361915 8:142215993-142216015 CCATCTGCTGAGGCAGGCAGAGG - Intronic
1049484829 8:142850283-142850305 GGACCTGCTGAGCCAGGCATGGG - Intronic
1049529526 8:143147432-143147454 GGAGCTGCTGACACAGGGAGGGG + Intergenic
1049825406 8:144664442-144664464 CCAGGTGCTGAGGCAGGAAGTGG - Intergenic
1050394175 9:5177834-5177856 ACAGCTGCTGTGCCAGACTGTGG + Intronic
1050526272 9:6549413-6549435 GCAGCAGGAGGGCCAGGCAGGGG + Intronic
1050604170 9:7283497-7283519 GGACCTGCTGAGGCAGGCATGGG + Intergenic
1051421109 9:16890335-16890357 TCAGCTACTGAGGGAGGCAGAGG - Intergenic
1051628013 9:19116598-19116620 GGAGCTGCTGAGTCAGGTTGCGG + Exonic
1051726255 9:20090089-20090111 GCAGCAGCTGACCCAAGGAGAGG + Intergenic
1051826948 9:21232325-21232347 GCAGCTGCTCAGGCATGCATGGG + Intronic
1052144030 9:25025616-25025638 ACAGCTGCTTTGCCAGGCTGTGG + Intergenic
1053209967 9:36219293-36219315 TGAGCTGCAAAGCCAGGCAGAGG - Intronic
1053311408 9:37023158-37023180 GCAGCAGGTTAGGCAGGCAGAGG + Intronic
1053351309 9:37415065-37415087 GCAGCAGCTGAGATGGGCAGTGG - Intergenic
1054889986 9:70240630-70240652 GGACCTGCTAAGCCAGGCACAGG - Intergenic
1055081840 9:72275423-72275445 GAAGCTGATGGGGCAGGCAGTGG - Intergenic
1055752555 9:79522833-79522855 GCTGCAGCCGAGGCAGGCAGGGG + Intergenic
1055807918 9:80117309-80117331 GGACCCGCTGAGCCAGGCACAGG + Intergenic
1055894791 9:81162604-81162626 GTACCTGCTAAGCCAGGCACCGG - Intergenic
1056348470 9:85723487-85723509 AGACCTGCTGAGCCAGGCACAGG + Intronic
1056457189 9:86771975-86771997 CCAGCTGTGGAGCCAGGCATAGG - Intergenic
1056722444 9:89083300-89083322 GCAGGTGCTGAAAGAGGCAGTGG + Intronic
1057180085 9:93025073-93025095 GCATCTGCTGGACCAGGCTGTGG + Intronic
1057769100 9:97951174-97951196 GGACCTGCCGAGCCAGGCACAGG + Intergenic
1057832900 9:98420275-98420297 GCTGGGGCTGAGCCAGGCATGGG - Intronic
1058074629 9:100638087-100638109 GGACCTGCTGAACCAGGCATGGG + Intergenic
1059354842 9:113690599-113690621 GCTGCTGCTGTGCCGCGCAGTGG + Intergenic
1059994588 9:119896565-119896587 GGAGATTCTGAGTCAGGCAGAGG - Intergenic
1060147822 9:121267851-121267873 GCAGCTCCTGAGCTGGGCTGGGG - Intronic
1060265674 9:122110301-122110323 GCAGCTCCAGGGCCGGGCAGCGG - Intergenic
1060404702 9:123367520-123367542 GCACCCTCAGAGCCAGGCAGGGG - Intronic
1060984663 9:127813235-127813257 GCTGCTGGTGTTCCAGGCAGCGG - Exonic
1061042756 9:128149473-128149495 GTGGCTGCTGGGCCTGGCAGGGG - Exonic
1061552398 9:131345184-131345206 GGACCTGCTGAGCCAGGCGCAGG + Intergenic
1061619033 9:131798978-131799000 GCACCTGGGGAGCCAGTCAGTGG - Intergenic
1061890461 9:133616615-133616637 GCTGCTGCTGGGACAGGCACAGG - Intergenic
1062072535 9:134565010-134565032 GCAGCTGCTGTGGGAAGCAGGGG + Intergenic
1062080462 9:134620844-134620866 ACAGCTGCTGAGACAGGCCCTGG + Intergenic
1062116950 9:134814668-134814690 GTATCTGCTGAGCCCTGCAGGGG - Intronic
1062266575 9:135689220-135689242 GCAGCTGCAGACGCAGGCAGAGG - Intergenic
1062396219 9:136353896-136353918 GGAGCTGCAGGTCCAGGCAGAGG - Intronic
1062536082 9:137021694-137021716 GCAGCCCCAGAGCCAGCCAGTGG - Intronic
1062575454 9:137205229-137205251 GTAGGTGCTGAGCCCGTCAGCGG + Exonic
1062643046 9:137531479-137531501 GCAGCTCCTCTGGCAGGCAGGGG + Intronic
1062712897 9:137986394-137986416 GTACCTGCGGGGCCAGGCAGGGG - Exonic
1203771979 EBV:54115-54137 GGAGCTGCTGACCGAGGCCGAGG - Intergenic
1203608598 Un_KI270748v1:76214-76236 ACAGCTGCAGAGGGAGGCAGGGG + Intergenic
1186002890 X:5033958-5033980 GTGGCTGCTGAACCAGGCATTGG - Intergenic
1186512933 X:10143956-10143978 GCAGGTGCAGATGCAGGCAGTGG + Exonic
1186760319 X:12716280-12716302 CCAGCAGCTGAGCCAGCCCGGGG + Exonic
1186858465 X:13648148-13648170 GCAACTGCGCAGGCAGGCAGAGG + Intergenic
1186866428 X:13724950-13724972 GGACCTGCCGAGCCAGGCATGGG - Intronic
1188044842 X:25413844-25413866 GGACCTCCTGAGCCAGGCATGGG + Intergenic
1188393153 X:29645796-29645818 GCGGCTGCTGAGCTTGGCATAGG - Intronic
1189283183 X:39833499-39833521 GCAGCCAGAGAGCCAGGCAGAGG - Intergenic
1189744567 X:44156970-44156992 GCTGCTGATGGGCCAGGCAGAGG + Intronic
1189748734 X:44196668-44196690 ACAGCTGCTGAGCCATCCAGGGG + Intronic
1189850666 X:45173353-45173375 GCAGCTTCTGGGCCAGGTATTGG + Intronic
1190137004 X:47806820-47806842 GTAGCTGGAGAGGCAGGCAGAGG + Intergenic
1191252722 X:58267138-58267160 GCAGCCCCTGGGCCAGGCTGGGG - Intergenic
1191258279 X:58289239-58289261 GCAGCTCCTGTGCCAGGCCTGGG + Intergenic
1191882429 X:65856452-65856474 GGACCTGCTGAGCCAGTCATGGG + Intergenic
1191886567 X:65894473-65894495 GGACCTGCCGAGCCAGGCATGGG + Intergenic
1192245893 X:69371308-69371330 GTAACTGCTGTGCCTGGCAGGGG + Intergenic
1192371858 X:70520930-70520952 GGACCTGCCGAGCCAGGCACGGG + Intergenic
1192612911 X:72585771-72585793 GGACCTGGTGAGCCAGGCATGGG - Intronic
1193435956 X:81475247-81475269 GGACCTGCTGATCCAGGCACGGG + Intergenic
1193640964 X:84009147-84009169 GGACCTGCCGAGCCAGGCACGGG - Intergenic
1195053488 X:101120827-101120849 CCAGGTACTGAGCCAGGCATTGG + Intronic
1195079327 X:101356123-101356145 GCAGCTGCTGAGTCTGGAAGCGG + Exonic
1195221027 X:102745742-102745764 GCGGCTGGGGACCCAGGCAGGGG - Intronic
1195746083 X:108119963-108119985 GCCGCTGCCAAGCCATGCAGTGG - Intronic
1195947402 X:110229855-110229877 GGAGCTGCCGAGCCAGGCACGGG - Intronic
1196139606 X:112246512-112246534 GCACCCGCTGAGCCAGGCATGGG + Intergenic
1196682757 X:118485501-118485523 CCATCAGCTGAGCCAGGGAGAGG - Intergenic
1196742543 X:119037952-119037974 CCATCAGCTGAGCCAGGGAGAGG - Intergenic
1197486406 X:127056619-127056641 GGACCTGCTGAGCCACGCACGGG + Intergenic
1197807974 X:130415677-130415699 CCTGCTGCTGACCCAGCCAGTGG - Intergenic
1197959624 X:131989810-131989832 GGACCTGCCGAGCCAGGCACAGG - Intergenic
1198115664 X:133542570-133542592 GCTACTGCTGAGCCAAGCATGGG + Intronic
1199247374 X:145621854-145621876 CCAGCTGCAGACCCAGGCAGAGG + Intergenic
1199344167 X:146719387-146719409 GGAGCTGCCGAGCCAGGCACGGG - Intergenic
1199466890 X:148148068-148148090 GCAGATGCTCAGTCAGGCAAAGG + Intergenic
1199481990 X:148307850-148307872 GAAGCTGCTCAGCTAGGAAGGGG - Intergenic
1199518950 X:148713175-148713197 GCAGCAGATGAGACAGGGAGGGG + Intronic
1199619055 X:149683156-149683178 GCAGCTTCTGAGCCAGGAGAAGG - Intergenic
1199911845 X:152295490-152295512 GGATCTGCTGAGCCAGGCATGGG + Intronic
1200120695 X:153788933-153788955 GCAGCCGAGGAGCCAGGCAGAGG + Intronic
1200405928 Y:2811431-2811453 GGACCTGCTGAGCCAGGCATGGG + Intergenic
1200648795 Y:5816358-5816380 GCAGGTCCTGAGCCATGCTGAGG + Intergenic
1200853561 Y:7911500-7911522 GCAGCTGCTGTGGATGGCAGGGG - Intergenic
1201361423 Y:13154431-13154453 ACAGCAGCTGTGGCAGGCAGTGG + Intergenic
1201725083 Y:17141943-17141965 GGAGCTTCTGAGCCAGGAAAAGG + Intergenic
1201901481 Y:19048834-19048856 GCAGGTGCTGTTCCAGGCACAGG + Intergenic
1202040207 Y:20674820-20674842 GAACCTGCTAAGCCAGGCATGGG - Intergenic
1202054705 Y:20817855-20817877 GAACCTGCCGAGCCAGGCACGGG - Intergenic