ID: 1024023607

View in Genome Browser
Species Human (GRCh38)
Location 7:45392171-45392193
Sequence TCTGCTGCAGCTGCTGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 670
Summary {0: 1, 1: 1, 2: 10, 3: 86, 4: 572}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024023607_1024023614 12 Left 1024023607 7:45392171-45392193 CCTGGCTCAGCAGCTGCAGCAGA 0: 1
1: 1
2: 10
3: 86
4: 572
Right 1024023614 7:45392206-45392228 CACAGATGGGGCCCCCGCTGGGG No data
1024023607_1024023613 11 Left 1024023607 7:45392171-45392193 CCTGGCTCAGCAGCTGCAGCAGA 0: 1
1: 1
2: 10
3: 86
4: 572
Right 1024023613 7:45392205-45392227 TCACAGATGGGGCCCCCGCTGGG No data
1024023607_1024023616 14 Left 1024023607 7:45392171-45392193 CCTGGCTCAGCAGCTGCAGCAGA 0: 1
1: 1
2: 10
3: 86
4: 572
Right 1024023616 7:45392208-45392230 CAGATGGGGCCCCCGCTGGGGGG No data
1024023607_1024023608 -2 Left 1024023607 7:45392171-45392193 CCTGGCTCAGCAGCTGCAGCAGA 0: 1
1: 1
2: 10
3: 86
4: 572
Right 1024023608 7:45392192-45392214 GAAACTGCCAGAGTCACAGATGG 0: 1
1: 1
2: 3
3: 34
4: 262
1024023607_1024023612 10 Left 1024023607 7:45392171-45392193 CCTGGCTCAGCAGCTGCAGCAGA 0: 1
1: 1
2: 10
3: 86
4: 572
Right 1024023612 7:45392204-45392226 GTCACAGATGGGGCCCCCGCTGG No data
1024023607_1024023609 -1 Left 1024023607 7:45392171-45392193 CCTGGCTCAGCAGCTGCAGCAGA 0: 1
1: 1
2: 10
3: 86
4: 572
Right 1024023609 7:45392193-45392215 AAACTGCCAGAGTCACAGATGGG 0: 1
1: 0
2: 1
3: 10
4: 171
1024023607_1024023615 13 Left 1024023607 7:45392171-45392193 CCTGGCTCAGCAGCTGCAGCAGA 0: 1
1: 1
2: 10
3: 86
4: 572
Right 1024023615 7:45392207-45392229 ACAGATGGGGCCCCCGCTGGGGG No data
1024023607_1024023610 0 Left 1024023607 7:45392171-45392193 CCTGGCTCAGCAGCTGCAGCAGA 0: 1
1: 1
2: 10
3: 86
4: 572
Right 1024023610 7:45392194-45392216 AACTGCCAGAGTCACAGATGGGG 0: 1
1: 0
2: 1
3: 16
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024023607 Original CRISPR TCTGCTGCAGCTGCTGAGCC AGG (reversed) Intergenic