ID: 1024023607

View in Genome Browser
Species Human (GRCh38)
Location 7:45392171-45392193
Sequence TCTGCTGCAGCTGCTGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 670
Summary {0: 1, 1: 1, 2: 10, 3: 86, 4: 572}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024023607_1024023608 -2 Left 1024023607 7:45392171-45392193 CCTGGCTCAGCAGCTGCAGCAGA 0: 1
1: 1
2: 10
3: 86
4: 572
Right 1024023608 7:45392192-45392214 GAAACTGCCAGAGTCACAGATGG 0: 1
1: 1
2: 3
3: 34
4: 262
1024023607_1024023615 13 Left 1024023607 7:45392171-45392193 CCTGGCTCAGCAGCTGCAGCAGA 0: 1
1: 1
2: 10
3: 86
4: 572
Right 1024023615 7:45392207-45392229 ACAGATGGGGCCCCCGCTGGGGG No data
1024023607_1024023616 14 Left 1024023607 7:45392171-45392193 CCTGGCTCAGCAGCTGCAGCAGA 0: 1
1: 1
2: 10
3: 86
4: 572
Right 1024023616 7:45392208-45392230 CAGATGGGGCCCCCGCTGGGGGG No data
1024023607_1024023610 0 Left 1024023607 7:45392171-45392193 CCTGGCTCAGCAGCTGCAGCAGA 0: 1
1: 1
2: 10
3: 86
4: 572
Right 1024023610 7:45392194-45392216 AACTGCCAGAGTCACAGATGGGG 0: 1
1: 0
2: 1
3: 16
4: 191
1024023607_1024023609 -1 Left 1024023607 7:45392171-45392193 CCTGGCTCAGCAGCTGCAGCAGA 0: 1
1: 1
2: 10
3: 86
4: 572
Right 1024023609 7:45392193-45392215 AAACTGCCAGAGTCACAGATGGG 0: 1
1: 0
2: 1
3: 10
4: 171
1024023607_1024023612 10 Left 1024023607 7:45392171-45392193 CCTGGCTCAGCAGCTGCAGCAGA 0: 1
1: 1
2: 10
3: 86
4: 572
Right 1024023612 7:45392204-45392226 GTCACAGATGGGGCCCCCGCTGG No data
1024023607_1024023613 11 Left 1024023607 7:45392171-45392193 CCTGGCTCAGCAGCTGCAGCAGA 0: 1
1: 1
2: 10
3: 86
4: 572
Right 1024023613 7:45392205-45392227 TCACAGATGGGGCCCCCGCTGGG No data
1024023607_1024023614 12 Left 1024023607 7:45392171-45392193 CCTGGCTCAGCAGCTGCAGCAGA 0: 1
1: 1
2: 10
3: 86
4: 572
Right 1024023614 7:45392206-45392228 CACAGATGGGGCCCCCGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024023607 Original CRISPR TCTGCTGCAGCTGCTGAGCC AGG (reversed) Intergenic
900105738 1:980314-980336 CCTGCAGGAGCTCCTGAGCCTGG - Exonic
900161358 1:1225509-1225531 GCTGCTGCGGCTGCTGAGGGAGG - Intronic
900186012 1:1333618-1333640 GCTGCTCCTGCTGCTGAGCCTGG + Exonic
900361565 1:2291565-2291587 TCTGGTCCAGCTGCTGTCCCGGG - Intronic
900394640 1:2448197-2448219 TTTCCTGCAGCTGCTGGGACCGG + Intronic
900409153 1:2505024-2505046 TCTGCTGCCGCTCCTGGGCCTGG - Exonic
900570336 1:3355190-3355212 CCAGATGCAGCTGCAGAGCCTGG - Intronic
900608119 1:3532823-3532845 TCAGCTGCGGCCGCTGTGCCAGG + Intronic
900977228 1:6025433-6025455 CCTACGCCAGCTGCTGAGCCTGG - Intronic
900985782 1:6072177-6072199 TCTGCCGCTGCTGTTGGGCCTGG + Intronic
901152014 1:7109981-7110003 TCTGCTGCCTATGGTGAGCCGGG + Intronic
901336742 1:8455719-8455741 CCTGCTCCAGGTGCTGGGCCAGG + Intronic
902191289 1:14765078-14765100 AGTGCTGCGGCTGATGAGCCCGG - Intronic
902924362 1:19686205-19686227 CCTGCAGAAGCTGCTCAGCCTGG + Intronic
903289483 1:22299013-22299035 TCTGCCACAGCTACTGAGCTGGG + Intergenic
903438942 1:23372632-23372654 TCTGTAGCAGCTGCTGAGCTGGG + Intergenic
903627938 1:24744988-24745010 GCTGCTGCTGTTGCTGTGCCAGG - Intergenic
903739048 1:25547690-25547712 CCTGCTGGAGATGCTGAGGCTGG - Intronic
903766662 1:25739627-25739649 TCCCCAGGAGCTGCTGAGCCAGG - Intronic
904324774 1:29721286-29721308 CCTGCTGCATCTGCAGGGCCTGG - Intergenic
904434242 1:30483948-30483970 TCTGCTGCATCTGCAGGGCCTGG + Intergenic
905534399 1:38708956-38708978 GCTGCTGCTGCTGCTCAGCGCGG + Intergenic
906320698 1:44813625-44813647 TCTGCTCCACCTGCAGAGCAAGG - Exonic
906448368 1:45922690-45922712 CCTGCTGCAGCTTCAGACCCAGG - Intronic
906581833 1:46941334-46941356 TCTGCTTCTGCTGCTGATCAAGG - Exonic
906601884 1:47137563-47137585 TCTGCTTCTGCTGCTGATCAAGG + Exonic
907523434 1:55039885-55039907 GCTGCTGCTGCTGCTGCTCCTGG + Exonic
907763432 1:57385095-57385117 CCTGCTGCTGCTGTTGATCCTGG - Intronic
908512081 1:64857577-64857599 TCTGCAGCAGCTCCTGAACCAGG + Intronic
908743823 1:67356199-67356221 TCTGCAGCAGCTTCAGGGCCAGG - Intronic
909519592 1:76551983-76552005 CCTGCAGCAGCTGCTGCTCCTGG - Intronic
911044627 1:93618090-93618112 GCTTCTGTAGCTACTGAGCCTGG - Intronic
911766611 1:101683806-101683828 TCTGCAGCTGTTGCTGTGCCTGG + Intergenic
912499532 1:110112861-110112883 CGTGCTGCAGCTGCTAAGGCAGG + Exonic
914000426 1:143690072-143690094 TGTGCTGCAGCTGAGGAGACGGG - Intergenic
914918015 1:151830227-151830249 TCTGCTGCTGCTGCGTGGCCGGG + Intronic
914992460 1:152510825-152510847 TCTGCTGCAGTGCCTGAACCAGG + Exonic
915164471 1:153941014-153941036 CCTGCAGCTGCTGCAGAGCCTGG - Exonic
915558070 1:156670889-156670911 TCTGCTGCGGGAGCTGAGCCAGG - Exonic
916482327 1:165225763-165225785 GCTGCTGCTGCTGCTGGTCCAGG + Intronic
917524439 1:175774622-175774644 TCTTCTCCAGCTGCTGAGGTGGG - Intergenic
917761558 1:178164886-178164908 TCTGCTGCATATTCTGAGTCTGG + Intronic
917797603 1:178543012-178543034 TCTCGTGCAGATGCTGGGCCGGG + Intronic
917840463 1:178973380-178973402 TCAGCTCCAGCTGCTGATTCTGG + Intergenic
918399908 1:184153062-184153084 ACTGCTGCACTTGCTGTGCCTGG - Intergenic
919753651 1:201053506-201053528 GCTGATCAAGCTGCTGAGCCGGG - Exonic
920281856 1:204849533-204849555 TCTGCTGATGCTGCTGGTCCAGG + Intronic
920346117 1:205306741-205306763 TCTCCTGCAGCTGCTAGCCCAGG + Intronic
920644312 1:207787996-207788018 GCTGATGCTGCTGCTGTGCCTGG + Intronic
920736830 1:208540440-208540462 GCTGTTGCAGATGTTGAGCCAGG - Intergenic
921217551 1:212950659-212950681 GCTGCTGCTGCTGCTGGGCCTGG - Exonic
922200192 1:223394384-223394406 GCTGCTGCTGCGGCAGAGCCAGG + Exonic
922620956 1:226987809-226987831 ACTGCTGAAGCTGCTGTACCTGG + Intergenic
922696248 1:227732418-227732440 GCTGCTGCAGCAGCTGAGAGAGG - Exonic
922704099 1:227779898-227779920 CCTTCTGCATCTGCTGGGCCGGG + Intronic
922959614 1:229635285-229635307 GCTGAGGCAGGTGCTGAGCCGGG + Exonic
1062966373 10:1610568-1610590 CCAGCACCAGCTGCTGAGCCGGG + Intronic
1063047268 10:2405096-2405118 TTTGCAGCACCTGCCGAGCCGGG + Intergenic
1064180350 10:13109230-13109252 TCTGCTGCAGCAGCTCCTCCGGG - Exonic
1064293239 10:14054290-14054312 TCTTCTGTGGCTGCTGACCCTGG + Intronic
1064415479 10:15145810-15145832 TCAGCTGTGGCTGCTTAGCCAGG + Intronic
1065023054 10:21516748-21516770 TCTGCTGCGGCGGCTGGGCCCGG + Exonic
1065122631 10:22543936-22543958 TCTCGTCCAGCTGCTGAGCCTGG - Intronic
1065350013 10:24786975-24786997 TCTGCTGCTGCTGCTGCTCCTGG + Intergenic
1065535806 10:26713791-26713813 TCTGCCCCAGCTGCTGTACCAGG + Intronic
1065748191 10:28860969-28860991 TCTGCTGGGGCTGCTGCTCCTGG - Intronic
1068919402 10:62466356-62466378 GCTGCAGCAGCTGGTGTGCCTGG + Intronic
1069146290 10:64896029-64896051 TCTGCAGCACCTGCCCAGCCTGG - Intergenic
1069933730 10:71900944-71900966 TCCGCTGCAGCTGCTGAGCCTGG + Intergenic
1070401491 10:76056804-76056826 CCAGCTGCAGCTGCAGACCCAGG - Intronic
1070599645 10:77856791-77856813 TCAGCTGCGGCTGATGACCCGGG - Exonic
1071116183 10:82223216-82223238 CCAGCTGCAGCTGCTGGGGCTGG - Intronic
1071569405 10:86688434-86688456 TCTGCTGGAACTGAGGAGCCTGG + Intronic
1071713408 10:88071916-88071938 GCTGCTGCAGTTGCTGTGCTGGG + Intergenic
1072568956 10:96642004-96642026 GTTGCTGCTGCTTCTGAGCCAGG + Intronic
1072662871 10:97373331-97373353 TCTGTGGCAGAAGCTGAGCCAGG + Intronic
1074673886 10:115826529-115826551 CCTCCTGCAGCTGGTGAGCAGGG + Intronic
1076549399 10:131268015-131268037 ACTGCTCCCACTGCTGAGCCTGG - Intronic
1076597890 10:131637253-131637275 AGGGCAGCAGCTGCTGAGCCTGG + Intergenic
1076773202 10:132678560-132678582 TGAGCTGCTGCTGCTCAGCCGGG + Intronic
1076878667 10:133229827-133229849 TCGCGTGCAGGTGCTGAGCCCGG + Intergenic
1076888533 10:133273340-133273362 TCTGCAGCAGGTGCTCAGCCTGG + Exonic
1077012255 11:384573-384595 CCTGCTGCCCCTGCGGAGCCTGG + Intergenic
1077195555 11:1278264-1278286 ACTGCTGCAGCTGCTGCTGCAGG - Intronic
1077480691 11:2813031-2813053 TCTGTTCCAGCTGGAGAGCCAGG - Intronic
1077711544 11:4542204-4542226 TCTACTGCAGCTTCTGTGCAAGG - Intergenic
1077893334 11:6435556-6435578 TCTACTTCAGAGGCTGAGCCCGG - Intronic
1078342162 11:10505421-10505443 TCTGCAGCAGCTGCTGGGGATGG - Intronic
1078449001 11:11426369-11426391 TGTGCTGCAGCTGAGGAGCCTGG - Intronic
1080333819 11:31174075-31174097 CCAGCTGCAGCTGCAGACCCAGG + Intronic
1080333840 11:31174165-31174187 CCAGCTGCAGCTGCAGACCCAGG + Intronic
1080502136 11:32880892-32880914 TCTACTCCAGATGCTGAGACAGG + Intergenic
1080637301 11:34135189-34135211 TCTGCAGCAGCTGCAGAGCACGG - Exonic
1081578480 11:44334640-44334662 TCGGCTGCAGCTGCTCCTCCTGG + Intergenic
1081715067 11:45244306-45244328 TCTTCTTCAGCTTCCGAGCCTGG + Exonic
1081929451 11:46858617-46858639 GCTGATGCAGCTGATGACCCAGG - Exonic
1082076763 11:47980981-47981003 GCTGCTGCTGCTGCTGCGCCTGG + Exonic
1082177886 11:49082728-49082750 GCTTCTGCAGCTCCTCAGCCTGG - Intergenic
1083378296 11:62243952-62243974 TCTGCAGCTTCTGCAGAGCCAGG + Intronic
1083448871 11:62728950-62728972 TCTGCTTCAGCTGCGGGGTCTGG + Exonic
1083735080 11:64675584-64675606 CCGGCTGCTGCTGCAGAGCCAGG + Intronic
1083811210 11:65107993-65108015 GCTGCCGCAGCTGCTGGGCCAGG - Exonic
1083822372 11:65180813-65180835 ACTGCAGCAGCTGCTGGGCTGGG + Exonic
1083883035 11:65557848-65557870 GCTGCTGCTGCTGCTGGGCCTGG - Exonic
1083938226 11:65881447-65881469 CCTCCTGCAGCCTCTGAGCCTGG - Exonic
1084101280 11:66951313-66951335 TCTGCAGGAGCAGCCGAGCCAGG - Intronic
1084307471 11:68296509-68296531 CCTGCGTCAGCTGCAGAGCCAGG - Intergenic
1084942415 11:72620076-72620098 TCTGCTGGAGCTCCTGTGCAAGG + Intronic
1084966209 11:72746022-72746044 TCTGCAGAGGCTCCTGAGCCTGG + Intronic
1085064090 11:73476086-73476108 TCTTCTGTATCTGCTGATCCTGG + Intronic
1085215511 11:74827083-74827105 TCTGCTGCAGCGGTGGAGCCTGG - Intronic
1085392774 11:76190952-76190974 CCTGCTGCAGCAGCTGTGACTGG + Intronic
1085781064 11:79409639-79409661 TCTGCTACAGCTGGTGTGCGTGG - Intronic
1086718019 11:90086762-90086784 GCTTCTGCAGCTCCTCAGCCTGG - Intergenic
1087225261 11:95591996-95592018 TCTCCTGCACCTGCTGAGCTTGG + Intergenic
1090221715 11:125032414-125032436 TCAACTGCAGCTGCTGTACCAGG - Intronic
1090331156 11:125933201-125933223 GCTGCTGCTGCTGCTGATCTGGG - Intergenic
1090956113 11:131514138-131514160 TCTGCTATAGCTGCTGAGGTGGG + Intronic
1091256589 11:134192786-134192808 TCTGCAGCAGCAGCTGGTCCAGG + Exonic
1091800732 12:3323124-3323146 ACTACTGCAGCTGCCGAGGCTGG + Intergenic
1092390894 12:8077831-8077853 TGTGCTGTAGCTGCTGTGTCAGG - Intergenic
1093182927 12:15987949-15987971 CCTGCCGCAGCTGATGTGCCTGG - Intronic
1093888008 12:24485960-24485982 GCTGCTGCTGCTGTTGAGACAGG + Intergenic
1095267209 12:40174413-40174435 TATGATGCAGCTGCAAAGCCAGG - Intergenic
1095548129 12:43396835-43396857 GCTGCTGCAGCTGCTGTGGTTGG - Intronic
1096386435 12:51197892-51197914 TCTGCAGCAGCGGCTGGGTCTGG + Exonic
1096636857 12:52965632-52965654 GCAGCCGCAGCTGCCGAGCCGGG - Intergenic
1097408439 12:59221561-59221583 TCTGCTGCAGAAGGTGTGCCAGG + Intergenic
1098278714 12:68840615-68840637 GCTGCTCCAGAGGCTGAGCCAGG - Exonic
1098404396 12:70108758-70108780 TGAGCTGCAGCTGCTGGGGCTGG + Intergenic
1098607102 12:72404318-72404340 GCTGCTGCAGAGGCTGAGACAGG + Intronic
1098826631 12:75305683-75305705 CCTTCTGCAGCAGCTGTGCCGGG - Intronic
1099072353 12:78061064-78061086 GCTGCTGCTGCTGCTGGTCCAGG - Intronic
1100456402 12:94755741-94755763 TCCCCTGCATTTGCTGAGCCAGG - Intergenic
1100717072 12:97317219-97317241 TTTGCTGCAGGAGCTCAGCCAGG + Intergenic
1101222285 12:102654228-102654250 TCTCCTGCAGCTGCAGAGCCAGG + Intergenic
1101428152 12:104604655-104604677 GCTGTTGAAGCTGCTGAGCCCGG + Intronic
1101580779 12:106039469-106039491 ACTGCAGCAGCTGGTGTGCCTGG - Intergenic
1101761793 12:107664747-107664769 GCTGCTGCTGCTGCTGGTCCAGG + Intergenic
1102483627 12:113241351-113241373 TCTGCTGCTGCTGCTGCTGCAGG - Intronic
1102833172 12:116026602-116026624 GCTGCTGCTGCTGCTGCTCCTGG + Intronic
1103461677 12:121109783-121109805 ACCGGTGCAGCTGCTGAGACAGG + Intergenic
1103597562 12:122032883-122032905 TCTTCTGAAGGTGCTCAGCCAGG - Intronic
1103618495 12:122170977-122170999 GCTGCTGCTGCTGCTGGGCCAGG + Intronic
1103869727 12:124082762-124082784 TCTGCTGCAACTACTTAGCAAGG + Intronic
1103932557 12:124458296-124458318 TCTGCTGCAGCCCGGGAGCCTGG - Intronic
1103981686 12:124740956-124740978 AGTGCTGCAGCTGCTGTCCCGGG - Intergenic
1104352317 12:128055682-128055704 GCTGCTGCAGGTGCTGAAGCTGG + Intergenic
1104415965 12:128596774-128596796 TCTGCTGGGGCTGCTGTGCGTGG - Intronic
1104724051 12:131065410-131065432 TCTGCTGGAGCCGCTGACCAAGG + Intronic
1104930958 12:132339270-132339292 CCAACTGCAGCTGCTGTGCCAGG - Intergenic
1105017772 12:132796538-132796560 CCTGCTCCAGCTGCTGCTCCAGG + Exonic
1106250163 13:27976930-27976952 GCTGCTGCTGCTGCTAACCCTGG + Intergenic
1106462225 13:29981173-29981195 GCTGCTGCAGCTGCAGAGGCTGG - Intergenic
1106583056 13:31034077-31034099 TCTGCTGCTGCTGCTCACGCTGG - Intergenic
1106720157 13:32428019-32428041 GCTGCTGCTGCTGCTGGGGCTGG + Exonic
1106776729 13:33016497-33016519 GCTGCTGGTGCTGCTGGGCCTGG + Exonic
1107542794 13:41408731-41408753 GAAGCTGCAGCTGCTGATCCAGG - Intergenic
1108643975 13:52408298-52408320 CCTTCTGCAGCTGCTGGCCCAGG + Intergenic
1109468246 13:62767725-62767747 GCTGCAGCAGCTGGTGTGCCTGG - Intergenic
1111454141 13:88457073-88457095 CCTCCTCCAGCTGCTGAACCTGG + Intergenic
1112006552 13:95258698-95258720 TCTGCTGCTGCTCTTCAGCCTGG - Intronic
1112326728 13:98446606-98446628 TCAGCTTCTGCTGCTGGGCCTGG - Intronic
1113821479 13:113216869-113216891 TTTGCTGTAGGTGCTGAGTCAGG - Intronic
1113906587 13:113822174-113822196 TCTCCTGCAGCTGGTGGTCCTGG - Exonic
1114035581 14:18624064-18624086 TTTGCTGCCACTACTGAGCCAGG + Intergenic
1114123056 14:19690958-19690980 TTTGCTGCCACTACTGAGCCAGG - Intergenic
1114155549 14:20099336-20099358 CCTGCTGCAGCTGCTGGCCCAGG - Intergenic
1114199913 14:20510507-20510529 GCTGATGCTGCTGCTGGGCCTGG + Exonic
1114207306 14:20584441-20584463 TCCTCTGCTGCTGCTCAGCCTGG - Exonic
1114528484 14:23380701-23380723 TGGGATGGAGCTGCTGAGCCAGG - Intergenic
1116024005 14:39494480-39494502 TTTGCTACAGCTGCTGTCCCAGG + Intergenic
1116725266 14:48554771-48554793 TCTGCTGCTGCTGCTGCTGCTGG + Intergenic
1117213498 14:53526239-53526261 TCTGCTGCAGCAGCTGCTCCTGG - Intergenic
1117258086 14:54000696-54000718 GCTGCTGCAGAGGGTGAGCCAGG + Intergenic
1117950755 14:61080732-61080754 TCTGCTACAGCTGCTGCACCGGG + Intronic
1118750904 14:68807350-68807372 TCTGCTGCAGCTGCTGGGTGAGG + Intergenic
1119436723 14:74602185-74602207 GCTGCTGCAAGTGCTGAGCTCGG - Intronic
1121216864 14:92255089-92255111 GCTGCTGCAGCCCCTGTGCCGGG - Intergenic
1121751615 14:96362880-96362902 TCTGCAGGAGAAGCTGAGCCTGG - Exonic
1121775139 14:96585325-96585347 ACTCCTGCAGCCGCTGGGCCTGG - Intergenic
1122175758 14:99917461-99917483 GCTGCTTCAGAGGCTGAGCCAGG + Intronic
1122325974 14:100880855-100880877 CCAGCTGCACCTGCTCAGCCGGG - Exonic
1123406018 15:20019910-20019932 TCTCCTGCATCTGCAGACCCTGG + Intergenic
1123515347 15:21026558-21026580 TCTCCTGCATCTGCAGACCCTGG + Intergenic
1124464109 15:29920712-29920734 CCTGCTGCTCCTGCTGAGCAAGG + Intronic
1125159620 15:36627898-36627920 GCAGGGGCAGCTGCTGAGCCAGG - Intronic
1126011124 15:44303675-44303697 GCTGCTCCAGATGCTGAGGCAGG - Intronic
1127833107 15:62768126-62768148 GCTGCTGAAGCTGCTGATCTGGG - Intronic
1128667166 15:69547099-69547121 TCACCTGCAGCTGCTGGCCCTGG + Intergenic
1129377827 15:75145314-75145336 TCAGCTGCAGCTGTGGACCCAGG - Intergenic
1129674210 15:77623574-77623596 TCTCCTGCAGGAGCTCAGCCTGG - Intronic
1129919915 15:79311288-79311310 TCTGCTGCTGCTCCTGCGCCGGG + Exonic
1130558935 15:84943971-84943993 TCTGCTGCTGCTGGTGGCCCAGG + Intronic
1130662713 15:85843267-85843289 TCTGCAGCATCTGCTGTGACAGG + Intergenic
1130956254 15:88629393-88629415 TGTGCAGCAGCTGCAGGGCCAGG - Exonic
1131107542 15:89745130-89745152 CCTGCTGCCTCTGCTGGGCCGGG - Intergenic
1131139349 15:89964449-89964471 CCTGCTGCTGCTGCTGCCCCAGG + Intergenic
1131193215 15:90333870-90333892 ACAGCTGCAGCAGCTGAGCCAGG - Intergenic
1132172842 15:99680103-99680125 GCTGCTGAAGCAGCTGAGTCTGG + Intronic
1132504139 16:298324-298346 TCTGCTGGGGCTGCTGGGTCAGG - Intronic
1132712741 16:1276705-1276727 GCTGCTGCTGCTGCTGTTCCTGG - Intergenic
1132938951 16:2497456-2497478 TCTGCTGTGGCTGCTGGGCGTGG + Intronic
1132989458 16:2785483-2785505 ACTGCTGCAGCTGCGTCGCCCGG - Exonic
1133036112 16:3035328-3035350 TCTGCTGCAGCTGCAAGGCTAGG + Exonic
1133152822 16:3849760-3849782 GCTGCTGCTGCTGCTGGTCCAGG + Intronic
1133216200 16:4293966-4293988 GCTGCTGCTGCTGCTGAAGCCGG - Intergenic
1133239336 16:4405136-4405158 TCGGCCGCAGGTGCTGGGCCAGG - Intronic
1133783794 16:8959838-8959860 TCAGCTGCAGCTTCTGATCTAGG - Intronic
1133784315 16:8963255-8963277 TCTGCTGCTGCTGCTGCTGCTGG + Exonic
1136049120 16:27638134-27638156 TGGGCTGCTGCTGCTTAGCCTGG + Intronic
1136267381 16:29129728-29129750 TCTGAGGCTGCTGCTGAGCCTGG + Intergenic
1137352426 16:47725127-47725149 TCTGGTTCAGCTGCAGAGCAAGG + Intergenic
1137786471 16:51141501-51141523 TCTGCTGCTGCTGCAGAGCTAGG + Exonic
1137876801 16:52004810-52004832 TCAGCTGCAGCAGCAGTGCCTGG - Intergenic
1139503143 16:67384894-67384916 TCTGCTGCAGCAGCTGAATAAGG + Exonic
1139625957 16:68188366-68188388 CCAGCTGCAGCTGCTGACCCGGG - Intronic
1139805945 16:69565800-69565822 GCTGCTGCTGTTCCTGAGCCGGG - Intronic
1139818104 16:69693620-69693642 GCTGCTGCTGCTGCTGTTCCTGG - Exonic
1139942384 16:70614534-70614556 TGTGGTGCAGCTGCTGAACACGG + Intronic
1141283785 16:82652644-82652666 GCTGCTGCTGCTGCTGAGGTTGG + Intronic
1141425824 16:83943812-83943834 CCTGCTGCTGCTGCTGCTCCAGG + Intronic
1141461321 16:84180173-84180195 GCAGCTGCAGCTGCTGCACCTGG - Exonic
1141463146 16:84190146-84190168 GCTGCTGCTGCTGCTGAAGCTGG - Intergenic
1141572359 16:84941635-84941657 GCTGCAGCAGTTGCTGAGCGCGG + Intergenic
1142070672 16:88090051-88090073 TCTGAGGCTGCTGCTGAGCCTGG + Intronic
1142626899 17:1197968-1197990 ACTGCCGCTGCTGCTGCGCCCGG + Intronic
1143282443 17:5764949-5764971 TTTGCTGCAGTTGCTAAGCCAGG + Intergenic
1143710111 17:8728542-8728564 ACTGCTGCAGCTGCCCTGCCAGG - Intergenic
1144586688 17:16491744-16491766 GCTGCTGCAGCACCTGCGCCAGG - Exonic
1144865535 17:18333059-18333081 GCAGCTGCAGCAGCAGAGCCTGG + Intronic
1145783141 17:27577286-27577308 TCTGCTTCAGCTGCTGTCTCTGG + Intronic
1146072151 17:29692793-29692815 ACTGCTGATGCTGCTGATCCAGG - Intronic
1146274835 17:31510012-31510034 CCTGCTGCAGCTGCCAACCCTGG - Intronic
1146456765 17:33014919-33014941 TCTGATGCAGATGCTTAGACAGG + Intronic
1146931665 17:36782383-36782405 TCTCCTGCAGCAGCTGAGCCAGG + Intergenic
1147133026 17:38419922-38419944 GCTGCTGCAGCTGCTGTGACTGG - Intergenic
1147239131 17:39079065-39079087 TCTGCTGCAACTCCTGTGCCAGG - Intronic
1147679016 17:42227603-42227625 TCTTCTGCAGCTCCTGCACCAGG + Exonic
1147686646 17:42289926-42289948 TCTTCTGCAGCTCCTGCACCAGG - Exonic
1148441211 17:47712495-47712517 TCCGAGGCAGCTGCTGAGCCTGG - Intergenic
1148606235 17:48931369-48931391 TCTCCTGAACATGCTGAGCCTGG - Intronic
1148623095 17:49049384-49049406 TCTGATGCTGCTGCTTAACCTGG - Exonic
1149494688 17:57109753-57109775 TCTGCTCCAGCAGCTGTGGCTGG + Intronic
1150014810 17:61543642-61543664 TCTACTCCAGAGGCTGAGCCAGG - Intergenic
1151601834 17:75110527-75110549 TCTGCGGCAGCTGCAGGTCCTGG + Exonic
1151679420 17:75615728-75615750 GCTGCTGCATCTGCTGCTCCAGG - Intergenic
1151758916 17:76089817-76089839 TTGGCTGCAGCTTCTGAGGCTGG + Intronic
1152147032 17:78574597-78574619 CCAGCAGCAGCTGCAGAGCCGGG - Intronic
1152147035 17:78574603-78574625 TCTGCAGCTGCTGCTGGCCCAGG + Intronic
1152267815 17:79306539-79306561 CCTGCCGCAGCCTCTGAGCCTGG + Intronic
1152405307 17:80094971-80094993 TCTGCTGCAGGATCTGACCCTGG + Intronic
1152466417 17:80469186-80469208 TCTGCAGCTGCAGCTGAGCCAGG + Exonic
1152531080 17:80919627-80919649 ACTGTTGCAGCTGCTGAAGCGGG - Intronic
1152946377 17:83199657-83199679 TCTGCTGCCGCTGCAGCTCCGGG - Intergenic
1153280701 18:3411689-3411711 CCTGCAGGAGCTTCTGAGCCTGG + Intronic
1153579882 18:6562256-6562278 TCTGTGGCAGCTGATGAGGCGGG + Intronic
1155897376 18:31346960-31346982 TCTCCTGCAGCTGCTTCTCCAGG - Intronic
1156203614 18:34861372-34861394 GCTGCTGCAGAGGCTGAGACAGG + Intronic
1156452795 18:37275929-37275951 TCTGCTGAAGCAGCAGTGCCTGG + Intronic
1157146239 18:45165554-45165576 TGTGCTGCTGCTGCTGAGGAGGG - Intergenic
1157359189 18:46962982-46963004 TCTGCAGGAGCCGCTGACCCCGG - Exonic
1157360183 18:46968909-46968931 TCTGCAGGAGCCGCTGACCCCGG - Exonic
1157360784 18:47022501-47022523 TCTGCAGGAGCCGCTGACCCCGG - Exonic
1157361773 18:47028416-47028438 TCTGCAGGAGCCGCTGACCCCGG - Exonic
1157610306 18:48951510-48951532 GCTGCGGCGGCGGCTGAGCCCGG + Intergenic
1157643036 18:49237008-49237030 TCTCCTGCAGTTGCTTATCCAGG + Intronic
1157754072 18:50202951-50202973 ACTGCTGAAGCTGCAGAGGCTGG - Intergenic
1159090408 18:63842146-63842168 ACACCTGCAGCCGCTGAGCCAGG - Intergenic
1160073899 18:75653632-75653654 GCTGCAGCACCTGCAGAGCCAGG + Intergenic
1160498300 18:79388046-79388068 TCTGCTGCAGCTGAGGACACAGG + Intergenic
1160619312 18:80159890-80159912 CCCGCTGCAGCCGCTGCGCCAGG + Exonic
1160701093 19:507779-507801 CCTGCTGCAGCAGCAGCGCCTGG + Exonic
1160727374 19:623344-623366 TCCGCCGCAGGGGCTGAGCCGGG - Intronic
1160727393 19:623406-623428 TCCGCCGCAGGGGCTGAGCCGGG - Intronic
1160840468 19:1144458-1144480 GCTGCTGCATCTGTTCAGCCCGG - Intronic
1161060401 19:2211815-2211837 CCTGCAGGAGCTGCTGGGCCAGG + Exonic
1161074009 19:2276231-2276253 GCTGCTGCTGCAGCTGAGCGCGG - Exonic
1161255922 19:3309486-3309508 ACTGCAGCAGCTGCTGCGCTGGG - Intergenic
1161304033 19:3557205-3557227 GCTGCTGCTGCTGCTGGGCCAGG - Exonic
1161378782 19:3953620-3953642 CCCCCTGCAGCTGCTGGGCCAGG - Intergenic
1161507518 19:4651893-4651915 TCTTCTGCGCCTGCAGAGCCAGG - Exonic
1161658605 19:5531544-5531566 TCTGCTGCATCTTCAGTGCCTGG - Intergenic
1161706312 19:5823755-5823777 GCGGCTGCAGCTGAGGAGCCAGG - Intergenic
1161722116 19:5908929-5908951 TGTCCTGCAGCAGCTCAGCCCGG - Exonic
1161780334 19:6287434-6287456 GCTGCAGCAGCTGGTGTGCCTGG + Intergenic
1161973302 19:7595866-7595888 GCCGCCGCCGCTGCTGAGCCAGG - Intergenic
1162212926 19:9107398-9107420 TCTGATGCAGCTTCCGAGCTGGG + Intergenic
1162316477 19:9941780-9941802 TTTGCTGATGCTGCTGAGCTTGG - Intergenic
1162545290 19:11325401-11325423 GCAGCTGCAGCTGCTGGGCTGGG + Exonic
1162569891 19:11465720-11465742 CCAGCTGCAGCTGCTGAGAAGGG + Intronic
1162771025 19:12949366-12949388 CCTGCTCCAGCAGCTGGGCCAGG + Exonic
1162935045 19:13978068-13978090 CCTGCTGGAGCTGCTGCACCTGG + Exonic
1163021361 19:14482576-14482598 GAAGCTGCAGATGCTGAGCCTGG - Intronic
1163124758 19:15238895-15238917 GCTGCTGCTGCTGCTGCTCCTGG + Exonic
1163149492 19:15402555-15402577 AGTGCTGCAGCTGTTGGGCCAGG + Intronic
1163313841 19:16529774-16529796 GCTGCTGCTGCTGCTGGGCCAGG + Exonic
1163478198 19:17539337-17539359 TCTCCTGCAGGTGCTGACCGCGG + Exonic
1164110110 19:22148699-22148721 ACTGCAGGACCTGCTGAGCCAGG - Intergenic
1164952912 19:32353707-32353729 TCTTCAGCAGCTGCTGCGCCTGG + Exonic
1165144532 19:33722828-33722850 GCAGCTGCAGAGGCTGAGCCAGG - Intronic
1166044947 19:40224535-40224557 TCGCCTGCAGCTGCTGGGCGTGG - Exonic
1166254909 19:41596660-41596682 TCTGCTGCAGGTGCTGACAATGG - Intronic
1166694848 19:44846585-44846607 GCTGCTGCTGCTGCTGCTCCTGG + Exonic
1167358199 19:49016684-49016706 GCTGTTGCTGCTGCTGAGCATGG - Exonic
1167359697 19:49023573-49023595 GCTGTTGCTGCTGCTGAGCATGG - Exonic
1167361434 19:49032512-49032534 GCTGTTGCTGCTGCTGAGCATGG + Exonic
1167362219 19:49036273-49036295 GCTGTTGCTGCTGCTGAGCATGG - Exonic
1167363864 19:49044585-49044607 GCTGTTGCTGCTGCTGAGCATGG + Exonic
1167364634 19:49048342-49048364 GCTGTTGCTGCTGCTGAGCATGG - Exonic
1167365919 19:49054978-49055000 GCTGTTGCTGCTGCTGAGCATGG - Exonic
1167435365 19:49475702-49475724 CCTGCTGCTGCTGCTGAGCTCGG + Exonic
1167744684 19:51343614-51343636 GCTGCTGCAGAGGCTGAGACGGG - Intergenic
1168222405 19:54970054-54970076 TCTCCTGGAGCAGCTCAGCCAGG + Exonic
1168400790 19:56085210-56085232 TCGGCTGCTGCTGCTGAAGCTGG - Intergenic
925128060 2:1475954-1475976 TCTGCTGCACCTCCTGTGCCTGG + Intronic
925592728 2:5526359-5526381 TCTGCTACTGCTGCTGTACCAGG + Intergenic
925687935 2:6492390-6492412 TCTCATGCAGTTGTTGAGCCTGG - Intergenic
926109098 2:10170745-10170767 TGTGCTGCCCCTGCTGTGCCAGG - Intronic
926143476 2:10382778-10382800 CCGGCTGCAGCTGCTGAGTGTGG + Intronic
926160758 2:10487727-10487749 TCTGGTGCAGCTGCACAGCCAGG - Intergenic
926305747 2:11636548-11636570 TCTGCCCCAGCTGCTGGGCTGGG - Intronic
926725864 2:15997394-15997416 ACAGGTGCTGCTGCTGAGCCGGG - Intergenic
927217733 2:20677961-20677983 GCTGCTGCTGCTGCTGCCCCAGG - Intergenic
927679403 2:25130044-25130066 TCTTCGGGAGCTGCTGGGCCGGG + Exonic
927785568 2:25972057-25972079 TCTTCTGGAGCTGCTGAACCAGG - Intronic
927880763 2:26688443-26688465 TCTGTGTCAGCTGCTGTGCCAGG + Intergenic
928061481 2:28117653-28117675 TCTTCTGCATCTGCAGAGACTGG + Intronic
928352480 2:30572542-30572564 TGTGCTGCACCTGTGGAGCCTGG + Intronic
928394396 2:30932472-30932494 TCTGCTGCAACTTCTTAGCCTGG + Intronic
929000803 2:37345142-37345164 TCGCCGGCGGCTGCTGAGCCGGG + Intronic
929782291 2:44964895-44964917 TCTGCCGAGGCGGCTGAGCCAGG - Intergenic
929791228 2:45024537-45024559 TTTCCTGCAGCTGCTGGCCCAGG + Intergenic
929870289 2:45753310-45753332 GATGCTGCACCTGCTGGGCCAGG + Intronic
930063431 2:47309801-47309823 CATGCTGCAGATGCTGAGCAGGG - Intergenic
930729127 2:54710359-54710381 CCTGCTGCAGCTGGAGTGCCTGG + Intergenic
930942410 2:57028447-57028469 GCAGCTCTAGCTGCTGAGCCAGG + Intergenic
932582378 2:73000223-73000245 TCAGCTGCAGTTTCTGGGCCAGG - Intronic
933996847 2:87676355-87676377 ACTGCTGCAGCTACTGCCCCGGG - Intergenic
934560079 2:95308612-95308634 TCTGCTGCTGCTGCAAAGGCTGG - Intronic
934572189 2:95379740-95379762 TCTGCAGCAGCGCCTGAGGCAGG - Intronic
934757564 2:96834796-96834818 TCTGCTGCAGCAGCCAATCCAGG + Intronic
936016602 2:108963974-108963996 TCAGCTGAGGCAGCTGAGCCTGG + Intronic
936145619 2:109978801-109978823 TCTCCTGCATTTGGTGAGCCTGG - Intergenic
936145980 2:109980908-109980930 TCTGCGGGAGCACCTGAGCCAGG - Intergenic
936198709 2:110390570-110390592 TCTGCGGGAGCACCTGAGCCAGG + Intergenic
936199067 2:110392677-110392699 TCTCCTGCATTTGGTGAGCCTGG + Intergenic
936290270 2:111217452-111217474 GCAGCTGCAGCTGCAGACCCAGG - Intergenic
936297004 2:111274555-111274577 ACTGCTGCAGCTACTGCCCCGGG + Intergenic
936598126 2:113868889-113868911 TCTGCTGCTGCTGCTGTGCCTGG - Intergenic
937322724 2:120970563-120970585 GTTGCTGCTGCTGCTGAGCTGGG - Exonic
937453276 2:122019967-122019989 CGTGCTGCAGCTGCACAGCCTGG - Intergenic
937543612 2:122988961-122988983 GCAGCTGCAGCTGCACAGCCCGG - Intergenic
937606676 2:123808531-123808553 TCTGCTGCTACTGCTGCACCTGG + Intergenic
937930275 2:127199420-127199442 TCTCCTGCAGCGTCAGAGCCTGG + Exonic
938096529 2:128467558-128467580 TTTGCCACAGCTGCAGAGCCAGG - Intergenic
938274816 2:130008886-130008908 TTTGCTGCCACTACTGAGCCAGG - Intergenic
938305473 2:130251650-130251672 TCTGCTGCAGCTGCTGGGGCAGG - Intergenic
938502311 2:131836429-131836451 TCTGCTGCTGCTGATGGGACTGG + Intergenic
938578694 2:132627062-132627084 TCTGCTGGAGTTGCTAAACCAGG - Intronic
938922728 2:136009771-136009793 GCTGCTGCTGCTGCTGGTCCAGG + Intergenic
939235658 2:139489131-139489153 TCTGCTGAATATGATGAGCCTGG + Intergenic
939728559 2:145753562-145753584 TCTGCTGCAGCTGCTCTTCAGGG + Intergenic
941043739 2:160649831-160649853 CCTGCTGCAGCTGGTATGCCTGG + Intergenic
942922323 2:181391025-181391047 TATGCTGCAGCTGCCTAGACAGG - Intergenic
943584985 2:189727876-189727898 TCTGCTGCAATTGCTGAGGTTGG + Exonic
943736884 2:191366039-191366061 GCTGCTGCTGCTGCTGGTCCAGG + Intronic
943965679 2:194328678-194328700 CCTGCTGCAGCCACTGTGCCTGG + Intergenic
944265981 2:197727266-197727288 TCTGCTGCTGCTGCTGAGCATGG + Exonic
945325300 2:208475006-208475028 GCTGCAGCAGCTGGTGAGCTTGG + Intronic
946131751 2:217611893-217611915 TCAGATGCAGCATCTGAGCCAGG + Intronic
946291673 2:218750113-218750135 GCTGCTGCAGCTGCTGGGGCTGG - Exonic
946306629 2:218860073-218860095 GCTGCTGCTGCTCCTGTGCCCGG + Exonic
947008044 2:225535129-225535151 TGTTCTGCAGCAGCTGAGCATGG + Intronic
947204104 2:227644586-227644608 ACTACTGTAGCTTCTGAGCCAGG + Intergenic
947629624 2:231643626-231643648 TCTACTGCAGATGCTGAGGTGGG + Intergenic
948034695 2:234848533-234848555 CCTGCTGCAGCTGCTGAGAAGGG - Intergenic
948174701 2:235934105-235934127 GCTGCTGCTGCTGCTGCTCCTGG - Intronic
948383966 2:237570166-237570188 GGTGGTGCAGCAGCTGAGCCTGG - Intergenic
948612130 2:239176440-239176462 GCTGCTGCAGCTTCTGCTCCCGG + Exonic
948630738 2:239301046-239301068 CCTGCTGCTGCTGCTCAGCCGGG + Intronic
948653740 2:239464438-239464460 TCTTCTACAGATGATGAGCCTGG + Intergenic
1168958886 20:1854763-1854785 GCTGCTGCTGCTGCTGGTCCTGG - Intergenic
1169065615 20:2692929-2692951 GCTGCTGCTGCTGCTGCTCCAGG + Exonic
1170479592 20:16752848-16752870 CCTGCTGCTGCTGCTGGTCCAGG - Intronic
1170808541 20:19655167-19655189 ACTGCAGCAGCTGCTGCGTCAGG - Intronic
1171178697 20:23075292-23075314 TCTGCTGATGCTGCTGGTCCAGG - Intergenic
1172045429 20:32076742-32076764 GCTGCTGCTGCTGCTGCTCCAGG + Intronic
1172406681 20:34694934-34694956 GCTGCTGCAGAGGCTGAGACAGG + Intergenic
1172485251 20:35294017-35294039 ACAGCTGCAGCTGGGGAGCCAGG + Intergenic
1172529209 20:35618636-35618658 GCTGCTGCAGCTGCTGCCCCTGG - Exonic
1172691767 20:36795048-36795070 TCTGCTCCGGATGCTGAGACAGG - Intronic
1172970933 20:38872627-38872649 GCTGCTGCTGCTGCTGGTCCAGG + Intronic
1173115050 20:40233387-40233409 TCAGCTGCAGCTGTGGAGTCCGG - Intergenic
1173518411 20:43681629-43681651 GCTGCTGCAGCTGTAGTGCCTGG + Intronic
1173537637 20:43828296-43828318 TCAGCTGCAGCTGCCTAGTCAGG - Intergenic
1173778763 20:45736036-45736058 CCTTCTGCAGCTGCTGGCCCAGG - Intergenic
1174081731 20:47974688-47974710 CCTGCTGCCTGTGCTGAGCCAGG + Intergenic
1174085742 20:48006147-48006169 TCGGCTTCTGCAGCTGAGCCAGG - Intergenic
1174134732 20:48371924-48371946 CCTGCTGCCTGTGCTGAGCCAGG - Intergenic
1174154256 20:48506462-48506484 GCTGCTGGAGCTGCTGATCAGGG - Intergenic
1174155674 20:48514011-48514033 GCTGCTGGAGCTGCTGATCAGGG - Intergenic
1174402965 20:50285758-50285780 TCTCCAGGAGCTGCTGACCCTGG - Intergenic
1174555239 20:51390531-51390553 TCTGCTGCAGCTGTACAACCTGG - Exonic
1174734996 20:52957376-52957398 GCTGCTGCTGCTGCTGATCCAGG - Intergenic
1174943647 20:54960359-54960381 GCTGCTGCAGCTGCTGGTCCAGG - Intergenic
1175362638 20:58425693-58425715 GCTGCTGCTGCTGCTGGCCCAGG - Intronic
1175610597 20:60347951-60347973 TCTGCTGCAGGTGCTGTCCTGGG + Intergenic
1175794412 20:61762709-61762731 GCTTCTGTAGCTGCAGAGCCTGG - Intronic
1176267782 20:64219792-64219814 GCTGCTGCAGCTGCTGCTGCTGG - Exonic
1177103638 21:16926227-16926249 TCTGCTGCTGCATCTGAGACTGG - Intergenic
1177237572 21:18412732-18412754 GCTGCTGCTGCTGCTGAGTTGGG + Intronic
1177404231 21:20645410-20645432 CCAGCTGCAGCTGCAGACCCAGG + Intergenic
1177624755 21:23645892-23645914 CCTGCTGCAGCTGGTGTGCCTGG - Intergenic
1179552749 21:42153917-42153939 GCTGCTCCTGCTGCTGGGCCGGG - Intergenic
1179974463 21:44856276-44856298 TCTGCTGCTGCTGCTGCTGCAGG - Exonic
1180177408 21:46097605-46097627 TCTGCAGGAGCTCCTGACCCGGG + Intergenic
1180459703 22:15551118-15551140 TTTGCTGCCACTACTGAGCCAGG + Intergenic
1180797050 22:18611065-18611087 GCTGCAGCAGCTGCTGCACCGGG - Exonic
1180878614 22:19187659-19187681 GCTTCTCCAGCTGCTGAGCCAGG + Exonic
1180989241 22:19924383-19924405 GATGCTGCAGCTGATGAGGCTGG - Intronic
1181224674 22:21384206-21384228 GCTGCAGCAGCTGCTGCACCGGG + Exonic
1181253958 22:21550607-21550629 GCTGCAGCAGCTGCTGCACCGGG - Exonic
1181362503 22:22348882-22348904 TCTGATGTAGCAGCTGAGCTGGG + Intergenic
1181522630 22:23458381-23458403 TCTCCTGCAGCTGCTGGGCAGGG - Intergenic
1182311394 22:29411040-29411062 TCTGCTGCATCTGAGGAGCTGGG + Intronic
1182689584 22:32149249-32149271 TCTGCTGCATCTGAAGAGCTGGG - Exonic
1183370206 22:37427753-37427775 GCCGCTGCAGCTGCAGCGCCCGG + Intergenic
1183601585 22:38843471-38843493 GCTGCTGCTGCTGCAGAGCACGG - Exonic
1183833114 22:40429723-40429745 TCAGCTTCAGCTGCTTGGCCTGG + Exonic
1183857304 22:40643726-40643748 TCTGCTGCTGCTGCTGAAAGGGG + Intergenic
1184226026 22:43129260-43129282 GCTGCTGCCGCTGCTCAGCGGGG + Exonic
1184231162 22:43159215-43159237 GCTGCTGCAGCTGCTGTTCAGGG - Exonic
1184894905 22:47401208-47401230 TCTGCTGTAGGTGCTGGGCATGG - Intergenic
1185203662 22:49523879-49523901 GCTGCTGCCGGTGCTGGGCCTGG - Intronic
1185344644 22:50305959-50305981 TCTACTGCAGCTGCCCAGACTGG - Intronic
1185371435 22:50462705-50462727 GCTCCTGCAGAAGCTGAGCCCGG - Exonic
949506795 3:4736391-4736413 TGTGCTGCACCTGCCAAGCCAGG - Intronic
950398239 3:12750482-12750504 TCTGTTATAGCAGCTGAGCCAGG + Intronic
950494371 3:13324812-13324834 GCTGCTGCTGCTGCTGTTCCAGG - Intronic
950520703 3:13496177-13496199 TCATCTCCAGCTGCTGAGGCTGG - Intronic
950571613 3:13803661-13803683 TCTGTGGCATCTGCTGTGCCTGG + Intergenic
951202533 3:19891070-19891092 ATTGCTGCTGCTGCTGAGACAGG + Intronic
951849804 3:27126557-27126579 GCTGCTGCTGCTGCTGATCCAGG - Intronic
952192523 3:31038844-31038866 CCTTCTGTAGCTCCTGAGCCAGG + Intergenic
952662723 3:35871105-35871127 GCTGCTGCTGCTGCTGACACAGG - Intergenic
954001752 3:47563097-47563119 TCTGCGGGGCCTGCTGAGCCCGG + Intronic
954208255 3:49076714-49076736 CCTGCTGCGGCTGCTGAACCTGG + Exonic
954218480 3:49137826-49137848 TTTGCTGCAGCTGGTGGGCGTGG + Intergenic
954698492 3:52439927-52439949 TCTGGTGTAGCTGCTGGGCCAGG + Exonic
955783161 3:62507614-62507636 GATGCTGAAGCTGCTGATCCAGG - Intronic
956304196 3:67805842-67805864 CCTGCTGCAGCCACTGAGTCTGG + Intergenic
956629181 3:71298052-71298074 TCTGTTGCAGCTACTCAGCAAGG - Intronic
956698273 3:71936878-71936900 TCTTCTGCAGCTGTTCGGCCAGG + Intergenic
958665898 3:97138264-97138286 TTTGCTGCAGTTGCTCAGCGGGG - Intronic
958977201 3:100682103-100682125 TCAGATGCAGATGCTGAGGCAGG + Intronic
960516541 3:118608306-118608328 TCTGCTGCAGCTCCTGTGGGGGG - Intergenic
960848202 3:122023782-122023804 GCTGCTGCTGCTGCTGTGCTAGG - Intergenic
961862498 3:129927805-129927827 TCTGATGCACCTCCAGAGCCTGG + Intergenic
962007444 3:131362261-131362283 TCTGCTGGAACTGCTGGGCGAGG + Intergenic
962847944 3:139287451-139287473 GCTGCTGCTGCTGCTGAGCTGGG + Intronic
962869475 3:139475658-139475680 TGTGCTCCAGGTGCTGAGCAAGG - Intronic
963045754 3:141101427-141101449 TCTGCCCCAGCTGCAGAGCGAGG - Intronic
963783740 3:149512391-149512413 TCGGCTGCACCCCCTGAGCCAGG + Intergenic
964421549 3:156509392-156509414 GCTGCTGCTGCTGCTGGTCCAGG + Intronic
965401732 3:168220543-168220565 CCTGCTGCTGCTCCTGACCCTGG - Intergenic
966003582 3:174980386-174980408 GCTGCTGCAGAGGCTGAGCCAGG + Intronic
967445698 3:189564095-189564117 TCTGCTGCAATTGGTTAGCCTGG + Intergenic
967607194 3:191461201-191461223 TCTTCTGGAGCAGCTCAGCCAGG + Exonic
967959511 3:194909188-194909210 TCTGCCGCCTCTGCTGGGCCTGG - Intergenic
968220908 3:196939212-196939234 TCTAATGTAGCTGCTGAACCAGG - Intronic
968481785 4:836374-836396 GCGACTGCAGCTGCTGAGGCTGG + Intergenic
968698103 4:2042405-2042427 GCTGCTGCTGCTGCTGAGTCTGG + Exonic
968871656 4:3245707-3245729 GCTGCTGGGGCTGCAGAGCCTGG - Intronic
969179131 4:5423955-5423977 TCAGCTGCAGCTGCAGACCTGGG + Intronic
969434889 4:7183299-7183321 TCTGCTGCTGCAGCCCAGCCTGG + Intergenic
969457577 4:7308873-7308895 TCTGCTGCTGCTGCTGTGCACGG - Intronic
970224682 4:13845513-13845535 TCTGCAGCAGGGGCTCAGCCAGG - Intergenic
971209661 4:24603537-24603559 TCTCCTGTAGCTGCTGAGTTGGG - Intergenic
972809018 4:42562406-42562428 GCTGCTGCTGCTGCTGCTCCTGG + Intronic
975022308 4:69503838-69503860 TCTGCTGCAGCTGCTTCACCTGG + Intronic
975082717 4:70300041-70300063 TCAGCTTCTACTGCTGAGCCTGG + Intergenic
976711725 4:88079198-88079220 TCTGCTTCAGCTGCATAGCTGGG - Intergenic
977570711 4:98626585-98626607 TCTGCTGCACCAGGTGGGCCAGG - Intronic
978154539 4:105474020-105474042 GCTGCTGCGGCTGCTGCGCACGG - Exonic
978866913 4:113523974-113523996 TCTGCTCGAGAGGCTGAGCCCGG - Intronic
980306385 4:131065571-131065593 TAAGCTGCAGCTGCAGACCCAGG - Intergenic
980599072 4:134995720-134995742 TCTTCTGCAGGAGCTGACCCTGG - Intergenic
982071708 4:151701278-151701300 ACTGCCCCATCTGCTGAGCCGGG + Intronic
982257621 4:153466221-153466243 GCTGCTGCAGCTCCAGACCCGGG - Intergenic
982484783 4:155953793-155953815 GCTGCTGTGGCTGCTGTGCCGGG - Exonic
983491741 4:168397899-168397921 GCAGCTGCAGCTGCAGACCCAGG + Intronic
984170301 4:176350794-176350816 GCAGCTGCAGCTGCTCAGCCAGG - Intergenic
984714586 4:182914676-182914698 TCTGCTGCCTGTGCTGAGCCTGG - Intronic
985559231 5:574106-574128 TCTCCTGCAGCTTCTAATCCTGG + Intergenic
985570164 5:640526-640548 GCTGCTGCTGCTGCTCAGCAAGG - Exonic
985572197 5:653012-653034 CCTGCTGCAGGAGCTGAGCCAGG + Exonic
985645652 5:1083595-1083617 CCAGCTGCTGCTGATGAGCCTGG - Intronic
985830330 5:2223412-2223434 TCTGCAGCAACTGCTGAACCTGG - Intergenic
986149085 5:5110461-5110483 ACTGAAGCAGGTGCTGAGCCAGG + Intergenic
986335142 5:6749119-6749141 CCTGCAGCGGCTGCTGAGCCAGG - Intronic
986336972 5:6762693-6762715 TCTGGTGCAGCTGGTGAGCGTGG - Intergenic
987789115 5:22541248-22541270 CCTGCAGCAGCTGCATAGCCAGG - Intronic
989134146 5:38136436-38136458 TCGGCTGCAGCTGCTGGGATGGG + Intergenic
989186811 5:38633969-38633991 GCTACTGGAGCTGCTGAGGCGGG - Intergenic
989523096 5:42423825-42423847 GCGGCGGCTGCTGCTGAGCCCGG + Intronic
989559680 5:42836508-42836530 CCCTCTGCAGCTGCTGACCCAGG - Intronic
990255102 5:53959942-53959964 ACTGCTGCATCTGTTGTGCCTGG + Intronic
990618951 5:57539279-57539301 ACTGGTGCAGCTCCTGAGGCTGG + Intergenic
991950115 5:71939161-71939183 TCTCCGGCGGCTGCTGAGTCAGG - Intergenic
993028184 5:82670469-82670491 TACCCTGCAGCTGCTGAACCAGG - Intergenic
994046370 5:95314906-95314928 GCTGCTGCTGCTGCTGGTCCAGG + Intergenic
995052745 5:107724802-107724824 TCTGCTGCTGCTGCTGCTGCTGG - Intergenic
995146130 5:108788273-108788295 CCTGCAGCAGCTGGTGTGCCTGG + Intronic
995229284 5:109740352-109740374 TTTGGTGTAGCTGCTGAGCCTGG + Intronic
996176898 5:120369477-120369499 TCTGCTGCAGCTGGCATGCCTGG + Intergenic
996790755 5:127290707-127290729 GCTGCTGCAGCTGCTGCTGCCGG - Intergenic
997598601 5:135124171-135124193 TCTGCTGCAGAGGCTGAGCTGGG - Intronic
997612686 5:135226313-135226335 ACTGCCGCTGCTGCTGCGCCCGG + Intronic
998794439 5:145803204-145803226 TCTGCAGCAGCAGCAGAGCCAGG - Intronic
999287790 5:150404607-150404629 TCTCCTGAAGCTGCTGAGGCCGG - Intronic
1000413677 5:160960809-160960831 ATTCCTGCAGCTGCTAAGCCAGG - Intergenic
1001406374 5:171480275-171480297 TCTGCTGCCGCTGCTGAACCAGG - Intergenic
1002170547 5:177371874-177371896 CCTGGTGGAGCTGCTGAACCGGG + Exonic
1002379818 5:178818475-178818497 ACTCCTGCACCTGCTCAGCCTGG + Intergenic
1002465442 5:179406044-179406066 CCTGCTGCTGCTGCTGGACCTGG + Intergenic
1003263295 6:4544339-4544361 TGTGCTGAAGCGGCTGAGGCAGG + Intergenic
1003336276 6:5175880-5175902 TCTACAGCTGCTGCTGATCCTGG + Intronic
1003607852 6:7581032-7581054 CCTGCTCCAGCTGCTGGGTCAGG - Exonic
1005400142 6:25423591-25423613 TATGCTTCAGCTCCTCAGCCAGG - Intronic
1005913474 6:30330807-30330829 TCTCCTGCAGCTTCTGTTCCAGG - Exonic
1006208040 6:32367116-32367138 TCTGGTGTAGCTGGTGGGCCTGG + Intronic
1006657416 6:35607698-35607720 CCTGCAGCAGCGGCTGTGCCTGG - Intronic
1006903130 6:37515851-37515873 TCTCATGCTGCTGATGAGCCAGG - Intergenic
1007270301 6:40630987-40631009 TCTCTTACAGATGCTGAGCCTGG + Intergenic
1007655727 6:43450028-43450050 TCTGCAGCAGCTGCTGGAACAGG - Exonic
1008392926 6:50973712-50973734 ACAGCTGCTACTGCTGAGCCAGG + Intergenic
1008501462 6:52187605-52187627 ACTGCTACTGCTGCTGAGCCTGG + Exonic
1008806241 6:55432045-55432067 TTTGCTGCTGCTGCTGCTCCTGG + Intergenic
1011319051 6:86069720-86069742 GCTGCTGCTGCTGCTGTACCTGG - Intergenic
1012815720 6:104019353-104019375 GCTGCTGCTGCTGCTGAACAAGG + Intergenic
1013215169 6:108020622-108020644 TCTGCTGCAGCCCCAGTGCCTGG + Intergenic
1013583592 6:111559464-111559486 CCTGCTGCGGCTGCTGAGAGAGG - Exonic
1014224102 6:118828495-118828517 GCTGCTGCAGAGGCTGAGGCAGG - Intronic
1014586297 6:123202091-123202113 CCTTCTGCAGCTGCTGGCCCAGG - Intergenic
1015350348 6:132210542-132210564 GCAGCTAAAGCTGCTGAGCCAGG + Intergenic
1015512074 6:134047931-134047953 TCTGCTGCTGCTTCAGAGCCTGG + Intronic
1015857966 6:137645973-137645995 TGTGCTGCAGCTGCTTAGTGTGG + Intergenic
1016422830 6:143902562-143902584 TCTGCTGCTGCTGCTCTGCAGGG + Intronic
1016618242 6:146077887-146077909 TCTGCTGCTTCAGGTGAGCCAGG + Intronic
1016842465 6:148538188-148538210 TCTGCTGTGTCTGCTGAGGCTGG + Intronic
1017052918 6:150409958-150409980 GCTGGGGCAGCAGCTGAGCCTGG - Intergenic
1017581659 6:155871723-155871745 TCTGCTACAGCTGCTCAAACAGG - Intergenic
1017703135 6:157095191-157095213 TCTGCTGAAGCTGCTGGTCTGGG + Intronic
1017840910 6:158222302-158222324 ACTGCTTCTGCTGCTGGGCCAGG + Intergenic
1018293147 6:162313775-162313797 TCTGATGCAGCGGCTGGGCATGG - Intronic
1018363141 6:163092974-163092996 ACTGATGCAGCTGGTGAGACCGG - Intronic
1019381631 7:727152-727174 GCTTGTGCAGCTGCTGGGCCTGG + Exonic
1019403835 7:872098-872120 TCTGGAGCACCTGCTGAGCCCGG - Intronic
1019477254 7:1249892-1249914 TCTGCTGGAGCAGTGGAGCCCGG + Intergenic
1019588696 7:1818163-1818185 TCTCCTGCAGCTGCCGGGCAGGG + Intronic
1020049474 7:5072397-5072419 GCTGCTGCTGCTGCTGCTCCCGG + Exonic
1020321074 7:6939283-6939305 TCTGCCGCAGCTGCTGCTCTGGG - Intergenic
1020367348 7:7394538-7394560 TCTGCTGCAGTTGCTGAGGTTGG + Intronic
1020622784 7:10537953-10537975 TCAGCTGCTGCTGCTGCTCCAGG + Intergenic
1020727280 7:11831820-11831842 CCTGCTGCTGCTGCTACGCCCGG - Exonic
1021513807 7:21461457-21461479 TCCTCCGCAGCTGCTGACCCAGG + Intronic
1021570152 7:22056925-22056947 GCTGCTGCTGCTGCTGATCTGGG + Intergenic
1023865418 7:44235986-44236008 TCTGCTGCTGCTGCTGCTGCTGG - Intronic
1024023607 7:45392171-45392193 TCTGCTGCAGCTGCTGAGCCAGG - Intergenic
1024470925 7:49768369-49768391 ACTGCTGCAGCTGCTGTGCCTGG + Intergenic
1024721641 7:52143405-52143427 TGTGGTGCAGCTGCAGGGCCCGG + Intergenic
1025094195 7:56084950-56084972 ACAGCTGCAGCTGGTGAGTCTGG + Intronic
1026446838 7:70492130-70492152 TATACTGCAGCTGTTGGGCCAGG - Intronic
1026625496 7:71988394-71988416 TCTGCCGCAGTTTCTGTGCCTGG - Intronic
1026824091 7:73570548-73570570 GCTGCAGCAGCAGCTGACCCAGG - Exonic
1026959700 7:74400495-74400517 GCTTCTCCACCTGCTGAGCCTGG - Exonic
1027052978 7:75031290-75031312 GCTGCTGCTGCTGGTGACCCGGG - Intronic
1027136954 7:75631437-75631459 GCTGCTCCAGATGCTGAGCCTGG - Intronic
1027924938 7:84448008-84448030 GCTGCAGCAGCTGGTGTGCCCGG + Intronic
1029374323 7:100168684-100168706 GCTGCAGCAGCTGCTGGGGCTGG - Exonic
1029667572 7:102005715-102005737 TCTACTCCACCTGCTGAGGCTGG + Intronic
1030125910 7:106152350-106152372 TTTGCTGTAGTTGGTGAGCCAGG + Intergenic
1030721845 7:112881011-112881033 TCAGCTGCGGCTGCAGACCCGGG + Intronic
1032794032 7:135263375-135263397 TCTGCAGCAGCTGGTGCACCTGG - Intergenic
1032919341 7:136527843-136527865 TCTGCTCCTGCTCCTGGGCCTGG - Intergenic
1033210813 7:139458940-139458962 GCTCCTGCAGGTGCTGAGGCAGG - Intronic
1034467324 7:151237763-151237785 CCTGCTGCGGCCACTGAGCCGGG + Exonic
1034900839 7:154907046-154907068 TCTGCTGCTGCTGCTGGCCCGGG - Intergenic
1034908079 7:154968556-154968578 TCTGCTGCTGCTGCTGCTGCTGG + Exonic
1034908110 7:154968898-154968920 TCTGCTGCTGCTGCTGCTGCTGG + Exonic
1036453934 8:8892440-8892462 GCTGCTGCAGCTGGTGGCCCTGG - Exonic
1036642691 8:10593897-10593919 AATGCTGCTGCTGCTCAGCCAGG - Intergenic
1036915342 8:12799119-12799141 CCTGCTGCAGCTGGTGTGCCTGG - Intergenic
1037063704 8:14548920-14548942 TCTACTGCAGTTGGTGAGGCTGG + Intronic
1037459578 8:19095443-19095465 TCTGCAGGAGCTGCTGGACCTGG - Intergenic
1037805177 8:22054865-22054887 CCTGCTGCCGCGGCTGAGCCGGG + Intronic
1037948475 8:23004035-23004057 TCTGCTGCCACTGCTCTGCCGGG + Intronic
1037985707 8:23289277-23289299 CTAGCTGCAGCTGCTCAGCCAGG + Intronic
1037989557 8:23311168-23311190 TCTGCTGCAGCCTGTAAGCCTGG - Intronic
1039789005 8:40859212-40859234 TCCTCTGCAGCTTCTGAGGCAGG - Intronic
1039881679 8:41629166-41629188 TCTCCTGCAGAGGCTGAGCAGGG - Intergenic
1041167345 8:55102676-55102698 GCTGCTGCTGCTGCTGCGCCGGG + Exonic
1041205597 8:55495315-55495337 TCTGCTGCAGCTCCAGACCCAGG - Intronic
1041313703 8:56540719-56540741 TCTGCTGGAGTTTATGAGCCTGG + Intergenic
1041503545 8:58567462-58567484 TCTGGTGCAGATGCTGATACTGG - Intronic
1041696476 8:60741975-60741997 TCTGCTGCATGTGCTGAGGGTGG - Exonic
1041698841 8:60765637-60765659 GCGGCTGCTGCTGCTGAGCTTGG + Intronic
1042169486 8:65978012-65978034 CCCTCTGCAGCTGCTGACCCAGG + Intergenic
1042274677 8:66991919-66991941 TCTGCTGCTGCTGCTGGTCTAGG + Intronic
1043414390 8:80033028-80033050 GCTGCAGCAGCTGGTGTGCCTGG - Intronic
1045248230 8:100461646-100461668 CCTATTGCAGCAGCTGAGCCTGG + Intergenic
1046945864 8:119973657-119973679 ACAGCTGCAGCAGCTGACCCTGG + Intronic
1046951232 8:120021440-120021462 TATGCAGCAGCTACTGAGCTAGG - Intronic
1047449968 8:124956362-124956384 CCTGCTGCAGCAGATGAGCAGGG + Intergenic
1047742763 8:127820082-127820104 TGGGATGCATCTGCTGAGCCTGG + Intergenic
1048073229 8:131041838-131041860 TCCTCTGCAGGTGCGGAGCCAGG + Exonic
1048885182 8:138903871-138903893 TCTGCTGGAGCTGCTGAGTTTGG + Intronic
1049095734 8:140547136-140547158 GCTGCTGCTGCTGCTGAGCCAGG + Intronic
1049372727 8:142275419-142275441 ACTGCTGCAGCCACCGAGCCCGG - Intronic
1049719942 8:144111139-144111161 TCCGCTGCCACTGATGAGCCAGG + Exonic
1049923771 9:389586-389608 GCTGCTGCTGCTGCTGGTCCAGG - Intronic
1051604926 9:18909405-18909427 TTTGCTGCAGCTGCACAGGCAGG - Exonic
1051985495 9:23081510-23081532 TTTGCTAATGCTGCTGAGCCAGG + Intergenic
1052583550 9:30393769-30393791 GCTGTTGCAGCTGCTGAGAAAGG + Intergenic
1052988072 9:34502350-34502372 TCTGCTGCAGCTACTGGGCCTGG + Intronic
1053139965 9:35676119-35676141 GCAGATGCAGCTGCAGAGCCCGG - Exonic
1056264126 9:84878992-84879014 ACTGCTGGAGATGCTGAGGCTGG - Intronic
1056266919 9:84906416-84906438 TCTGCTGAAGCTGCTCTGCAAGG - Intronic
1056475258 9:86946680-86946702 GCTGCTGCAGCTGCTGGGCTCGG - Exonic
1056792850 9:89637473-89637495 TCTGGTGCAGATGATGGGCCTGG - Intergenic
1056972987 9:91224066-91224088 TCGGCTGCTGCTGCTGAGATGGG - Intronic
1057492190 9:95529054-95529076 GCTGCTGCTGCTGCTGCTCCAGG - Intergenic
1058619103 9:106864157-106864179 GCTGCTGCAGCTGCTGGTGCCGG + Intronic
1058809611 9:108626903-108626925 CCTGCGGCGGCTGCTGTGCCTGG - Intergenic
1060165637 9:121411983-121412005 TCTGCTACTGCTGCTGAGGTGGG + Intergenic
1060552330 9:124491517-124491539 GCTGCTGGTGCTGCTGGGCCTGG - Intronic
1061237920 9:129352790-129352812 TCGGCTGCATCTGCTGGCCCAGG + Intergenic
1061344364 9:130010350-130010372 TCTGCTACATCTGGTTAGCCAGG - Intronic
1061358413 9:130123910-130123932 TCTGCTGCAGCCCCAGAGGCAGG + Intronic
1061920405 9:133779411-133779433 GCTGCTGCTGCTGCTGGGCCAGG - Intronic
1061926210 9:133807290-133807312 CCTGCGGCTGGTGCTGAGCCCGG - Exonic
1061968982 9:134033650-134033672 GGAGCTGCTGCTGCTGAGCCTGG + Exonic
1061974124 9:134059850-134059872 GCTGCTGCTGCTGCTGCGACAGG - Intronic
1062238576 9:135524177-135524199 TCTGCTGCAGATACCGAGGCCGG - Intronic
1062342119 9:136098385-136098407 TCTGCTGTACCTGCTGCCCCAGG + Intergenic
1062472820 9:136713687-136713709 TCTTCTGCAGCTGCTGGTCGAGG - Intronic
1062497127 9:136837250-136837272 TCTGCTGCTGCTGCTGGGGCTGG - Intronic
1062567719 9:137170672-137170694 TCTGCCACAGCTGGTCAGCCCGG - Intronic
1062617241 9:137403416-137403438 GCTGCTGCTGCTGCTGGGCTGGG - Intronic
1185452227 X:288797-288819 GCTGCTGCAGCTGCTGAACAAGG + Exonic
1187507210 X:19887496-19887518 GCTGCTGCCGCTGCTGCCCCGGG + Exonic
1189124203 X:38428702-38428724 TCTGCTGATGCTGCTGTTCCAGG + Intronic
1189146541 X:38660974-38660996 ACTGCTGCAGCTGCTGTGCCAGG - Intronic
1189534712 X:41923867-41923889 CCGGCTGCAGCTGCCGAGGCGGG + Intergenic
1190051904 X:47156791-47156813 GCTGCTGCAGCAGCTGTGGCTGG + Intronic
1190561596 X:51691316-51691338 TCTGCAGAAGCTGCTGATTCAGG + Intergenic
1190562695 X:51701999-51702021 TCTGCAGAAGCTGCTGATTCAGG - Intergenic
1191874923 X:65786968-65786990 TCTGGCGGAGCTGCTGAGGCTGG + Intergenic
1192260894 X:69505335-69505357 TCTGCTGCTGCTGCTGCTGCTGG + Exonic
1192435438 X:71140827-71140849 TCTGCTGCTGCTGCTGCTGCCGG - Exonic
1195079326 X:101356117-101356139 TCTCTAGCAGCTGCTGAGTCTGG + Exonic
1195667632 X:107445217-107445239 TCAAATGCAGCTGCTGAGCAGGG - Intergenic
1195720022 X:107858215-107858237 TCTGCTGCGGCTGGAGAGCATGG + Intronic
1195828234 X:109025857-109025879 TCCATTGCACCTGCTGAGCCAGG - Intergenic
1195914271 X:109920567-109920589 TCTCCTGAAGCTTCTCAGCCCGG - Intergenic
1197262437 X:124333244-124333266 CCAGCTGCAGCAGCTGCGCCTGG + Intronic
1197345068 X:125320446-125320468 CCAGCTGCAGCAGCTGCGCCTGG + Intergenic
1200179073 X:154139404-154139426 GCAGCTGCAGCTGCGGAGCACGG + Intergenic
1202100585 Y:21303788-21303810 TCTTCTGCAGCTGCTTGCCCAGG + Intergenic