ID: 1024023609

View in Genome Browser
Species Human (GRCh38)
Location 7:45392193-45392215
Sequence AAACTGCCAGAGTCACAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 171}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024023601_1024023609 29 Left 1024023601 7:45392141-45392163 CCGGAGGTCCAGGAGATAACCTG 0: 1
1: 0
2: 1
3: 10
4: 144
Right 1024023609 7:45392193-45392215 AAACTGCCAGAGTCACAGATGGG 0: 1
1: 0
2: 1
3: 10
4: 171
1024023600_1024023609 30 Left 1024023600 7:45392140-45392162 CCCGGAGGTCCAGGAGATAACCT 0: 1
1: 0
2: 2
3: 13
4: 177
Right 1024023609 7:45392193-45392215 AAACTGCCAGAGTCACAGATGGG 0: 1
1: 0
2: 1
3: 10
4: 171
1024023605_1024023609 10 Left 1024023605 7:45392160-45392182 CCTGGCCACTGCCTGGCTCAGCA 0: 1
1: 0
2: 11
3: 69
4: 459
Right 1024023609 7:45392193-45392215 AAACTGCCAGAGTCACAGATGGG 0: 1
1: 0
2: 1
3: 10
4: 171
1024023606_1024023609 5 Left 1024023606 7:45392165-45392187 CCACTGCCTGGCTCAGCAGCTGC 0: 1
1: 1
2: 11
3: 161
4: 781
Right 1024023609 7:45392193-45392215 AAACTGCCAGAGTCACAGATGGG 0: 1
1: 0
2: 1
3: 10
4: 171
1024023603_1024023609 21 Left 1024023603 7:45392149-45392171 CCAGGAGATAACCTGGCCACTGC 0: 1
1: 0
2: 0
3: 20
4: 158
Right 1024023609 7:45392193-45392215 AAACTGCCAGAGTCACAGATGGG 0: 1
1: 0
2: 1
3: 10
4: 171
1024023607_1024023609 -1 Left 1024023607 7:45392171-45392193 CCTGGCTCAGCAGCTGCAGCAGA 0: 1
1: 1
2: 10
3: 86
4: 572
Right 1024023609 7:45392193-45392215 AAACTGCCAGAGTCACAGATGGG 0: 1
1: 0
2: 1
3: 10
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024023609 Original CRISPR AAACTGCCAGAGTCACAGAT GGG Intergenic