ID: 1024023613 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:45392205-45392227 |
Sequence | TCACAGATGGGGCCCCCGCT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1024023606_1024023613 | 17 | Left | 1024023606 | 7:45392165-45392187 | CCACTGCCTGGCTCAGCAGCTGC | 0: 1 1: 1 2: 11 3: 161 4: 781 |
||
Right | 1024023613 | 7:45392205-45392227 | TCACAGATGGGGCCCCCGCTGGG | No data | ||||
1024023605_1024023613 | 22 | Left | 1024023605 | 7:45392160-45392182 | CCTGGCCACTGCCTGGCTCAGCA | 0: 1 1: 0 2: 11 3: 69 4: 459 |
||
Right | 1024023613 | 7:45392205-45392227 | TCACAGATGGGGCCCCCGCTGGG | No data | ||||
1024023607_1024023613 | 11 | Left | 1024023607 | 7:45392171-45392193 | CCTGGCTCAGCAGCTGCAGCAGA | 0: 1 1: 1 2: 10 3: 86 4: 572 |
||
Right | 1024023613 | 7:45392205-45392227 | TCACAGATGGGGCCCCCGCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1024023613 | Original CRISPR | TCACAGATGGGGCCCCCGCT GGG | Intergenic | ||