ID: 1024023616

View in Genome Browser
Species Human (GRCh38)
Location 7:45392208-45392230
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024023605_1024023616 25 Left 1024023605 7:45392160-45392182 CCTGGCCACTGCCTGGCTCAGCA 0: 1
1: 0
2: 11
3: 69
4: 459
Right 1024023616 7:45392208-45392230 CAGATGGGGCCCCCGCTGGGGGG No data
1024023607_1024023616 14 Left 1024023607 7:45392171-45392193 CCTGGCTCAGCAGCTGCAGCAGA 0: 1
1: 1
2: 10
3: 86
4: 572
Right 1024023616 7:45392208-45392230 CAGATGGGGCCCCCGCTGGGGGG No data
1024023606_1024023616 20 Left 1024023606 7:45392165-45392187 CCACTGCCTGGCTCAGCAGCTGC 0: 1
1: 1
2: 11
3: 161
4: 781
Right 1024023616 7:45392208-45392230 CAGATGGGGCCCCCGCTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024023616 Original CRISPR CAGATGGGGCCCCCGCTGGG GGG Intergenic