ID: 1024024853

View in Genome Browser
Species Human (GRCh38)
Location 7:45401327-45401349
Sequence ATAAGCCATCTGTGTAACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024024850_1024024853 -2 Left 1024024850 7:45401306-45401328 CCCAAGCACTTCACTCTATAGAT No data
Right 1024024853 7:45401327-45401349 ATAAGCCATCTGTGTAACCTGGG No data
1024024849_1024024853 -1 Left 1024024849 7:45401305-45401327 CCCCAAGCACTTCACTCTATAGA No data
Right 1024024853 7:45401327-45401349 ATAAGCCATCTGTGTAACCTGGG No data
1024024851_1024024853 -3 Left 1024024851 7:45401307-45401329 CCAAGCACTTCACTCTATAGATA No data
Right 1024024853 7:45401327-45401349 ATAAGCCATCTGTGTAACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024024853 Original CRISPR ATAAGCCATCTGTGTAACCT GGG Intergenic
No off target data available for this crispr