ID: 1024026220

View in Genome Browser
Species Human (GRCh38)
Location 7:45412209-45412231
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024026217_1024026220 26 Left 1024026217 7:45412160-45412182 CCACATAAAAATGGAAGTTTCTG No data
Right 1024026220 7:45412209-45412231 TCTCCTTGATTTTGTTCATGTGG No data
1024026216_1024026220 30 Left 1024026216 7:45412156-45412178 CCAACCACATAAAAATGGAAGTT No data
Right 1024026220 7:45412209-45412231 TCTCCTTGATTTTGTTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024026220 Original CRISPR TCTCCTTGATTTTGTTCATG TGG Intergenic