ID: 1024031170

View in Genome Browser
Species Human (GRCh38)
Location 7:45461026-45461048
Sequence CCCTTTCCCAGCGTGAGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024031167_1024031170 8 Left 1024031167 7:45460995-45461017 CCACTGATTTGATGTGTGATTTT No data
Right 1024031170 7:45461026-45461048 CCCTTTCCCAGCGTGAGCCTTGG No data
1024031166_1024031170 9 Left 1024031166 7:45460994-45461016 CCCACTGATTTGATGTGTGATTT No data
Right 1024031170 7:45461026-45461048 CCCTTTCCCAGCGTGAGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024031170 Original CRISPR CCCTTTCCCAGCGTGAGCCT TGG Intergenic
No off target data available for this crispr