ID: 1024034335

View in Genome Browser
Species Human (GRCh38)
Location 7:45494965-45494987
Sequence TGGCTGCCCCTTTGTGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024034326_1024034335 22 Left 1024034326 7:45494920-45494942 CCAGTCAGGAAGCACAGGATCAG No data
Right 1024034335 7:45494965-45494987 TGGCTGCCCCTTTGTGGAGGGGG No data
1024034325_1024034335 23 Left 1024034325 7:45494919-45494941 CCCAGTCAGGAAGCACAGGATCA No data
Right 1024034335 7:45494965-45494987 TGGCTGCCCCTTTGTGGAGGGGG No data
1024034330_1024034335 -4 Left 1024034330 7:45494946-45494968 CCTACTTGATGAAGCACTCTGGC No data
Right 1024034335 7:45494965-45494987 TGGCTGCCCCTTTGTGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024034335 Original CRISPR TGGCTGCCCCTTTGTGGAGG GGG Intergenic
No off target data available for this crispr