ID: 1024039348

View in Genome Browser
Species Human (GRCh38)
Location 7:45538478-45538500
Sequence ATGCAGAGCAAGAAGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024039346_1024039348 9 Left 1024039346 7:45538446-45538468 CCTTAATAAACTAGAAAAGAAGA No data
Right 1024039348 7:45538478-45538500 ATGCAGAGCAAGAAGAAGGAAGG No data
1024039343_1024039348 22 Left 1024039343 7:45538433-45538455 CCCTAATATTCCACCTTAATAAA No data
Right 1024039348 7:45538478-45538500 ATGCAGAGCAAGAAGAAGGAAGG No data
1024039344_1024039348 21 Left 1024039344 7:45538434-45538456 CCTAATATTCCACCTTAATAAAC No data
Right 1024039348 7:45538478-45538500 ATGCAGAGCAAGAAGAAGGAAGG No data
1024039345_1024039348 12 Left 1024039345 7:45538443-45538465 CCACCTTAATAAACTAGAAAAGA No data
Right 1024039348 7:45538478-45538500 ATGCAGAGCAAGAAGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024039348 Original CRISPR ATGCAGAGCAAGAAGAAGGA AGG Intergenic
No off target data available for this crispr