ID: 1024041517

View in Genome Browser
Species Human (GRCh38)
Location 7:45559723-45559745
Sequence GTCCTGTGACCCCCACCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024041512_1024041517 18 Left 1024041512 7:45559682-45559704 CCAACTGACTCTACCTGAACCCA No data
Right 1024041517 7:45559723-45559745 GTCCTGTGACCCCCACCCAGAGG No data
1024041514_1024041517 -1 Left 1024041514 7:45559701-45559723 CCCATGACTCATGACTCAACTGG No data
Right 1024041517 7:45559723-45559745 GTCCTGTGACCCCCACCCAGAGG No data
1024041513_1024041517 5 Left 1024041513 7:45559695-45559717 CCTGAACCCATGACTCATGACTC No data
Right 1024041517 7:45559723-45559745 GTCCTGTGACCCCCACCCAGAGG No data
1024041516_1024041517 -2 Left 1024041516 7:45559702-45559724 CCATGACTCATGACTCAACTGGT No data
Right 1024041517 7:45559723-45559745 GTCCTGTGACCCCCACCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024041517 Original CRISPR GTCCTGTGACCCCCACCCAG AGG Intergenic
No off target data available for this crispr