ID: 1024042572

View in Genome Browser
Species Human (GRCh38)
Location 7:45566744-45566766
Sequence GTCCCAAGAATCCACACTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024042568_1024042572 7 Left 1024042568 7:45566714-45566736 CCCAAGTCCATCTGGGACAAGCA No data
Right 1024042572 7:45566744-45566766 GTCCCAAGAATCCACACTCAAGG No data
1024042569_1024042572 6 Left 1024042569 7:45566715-45566737 CCAAGTCCATCTGGGACAAGCAA No data
Right 1024042572 7:45566744-45566766 GTCCCAAGAATCCACACTCAAGG No data
1024042570_1024042572 0 Left 1024042570 7:45566721-45566743 CCATCTGGGACAAGCAAAAACCT No data
Right 1024042572 7:45566744-45566766 GTCCCAAGAATCCACACTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024042572 Original CRISPR GTCCCAAGAATCCACACTCA AGG Intergenic
No off target data available for this crispr