ID: 1024043764

View in Genome Browser
Species Human (GRCh38)
Location 7:45574279-45574301
Sequence GGGGCTCGGCTGTCGCAGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024043759_1024043764 -5 Left 1024043759 7:45574261-45574283 CCCAGGTTCGCGGCTCCCGGGGC 0: 1
1: 0
2: 1
3: 12
4: 110
Right 1024043764 7:45574279-45574301 GGGGCTCGGCTGTCGCAGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 127
1024043760_1024043764 -6 Left 1024043760 7:45574262-45574284 CCAGGTTCGCGGCTCCCGGGGCT 0: 1
1: 0
2: 1
3: 6
4: 124
Right 1024043764 7:45574279-45574301 GGGGCTCGGCTGTCGCAGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024043764 Original CRISPR GGGGCTCGGCTGTCGCAGCG CGG Intronic
900159598 1:1217283-1217305 GGGGCTGGGCTGTGGCCCCGCGG - Exonic
900307685 1:2019187-2019209 GGGGCGCGGCTGGCGGAGGGGGG + Intergenic
905066886 1:35192242-35192264 CGGGCCCGGCGGCCGCAGCGAGG - Exonic
905772293 1:40646091-40646113 GGGCCTCGGCTGTCTCATCTGGG + Intronic
906607804 1:47183761-47183783 GGGGCTCGGCTGTGGCCCTGGGG - Exonic
906614617 1:47225741-47225763 GGGGCTCCGCTGCGGCCGCGCGG + Exonic
906640564 1:47438398-47438420 GGGGGGCGGCGGCCGCAGCGGGG + Exonic
909958078 1:81802343-81802365 GGGGCTCGGCTGTTGCTGTTCGG + Intronic
915040894 1:152967523-152967545 GTGGCTCGGCTGGGGCAGTGGGG + Intergenic
915325878 1:155080906-155080928 GGGCCGCGGCTGCCGCAGTGAGG - Intronic
916556239 1:165896471-165896493 GGGGCTGGACTGACGCAGCCGGG - Intronic
1064209097 10:13348162-13348184 GGGGCTCGCCTGCCTCGGCGCGG + Exonic
1065177889 10:23096066-23096088 GGGCCTGGGCTGTAGCAGCCCGG + Intronic
1066180646 10:32958110-32958132 GGGCCTCGGGTGTGGGAGCGCGG - Intronic
1067066029 10:43104858-43104880 GGGGCTCTGCGGTCAGAGCGGGG - Intronic
1067831730 10:49614490-49614512 TGGGCTGGGCTGGCGGAGCGCGG + Intronic
1070333071 10:75431664-75431686 GGGGCGCGGCGGCAGCAGCGGGG - Intronic
1075054464 10:119207386-119207408 GGCGCGCGGCTGTCGGAGCGAGG - Intergenic
1076582378 10:131520351-131520373 GGGGGTCGGCTGGCGAAGCGGGG - Intergenic
1078057339 11:8019068-8019090 GGGGCGCGGCTGCGGCAGCCTGG - Intergenic
1080615300 11:33940471-33940493 GGGGCTGGGCTGAAGCAGGGTGG - Intergenic
1084973098 11:72781849-72781871 GGGGCTCGGCGGCCGCGGCTCGG + Intronic
1089397528 11:118145848-118145870 CGGACTCGGCTGGCCCAGCGAGG - Intronic
1091337292 11:134781952-134781974 GGGGCTCTGCTGGCACAGCATGG - Intergenic
1091798973 12:3312873-3312895 GGGGCTCTGCTGGTGCAGCATGG - Intergenic
1096980374 12:55725167-55725189 GGGGCTGGGCTCTCGCAGGTGGG + Intergenic
1098275641 12:68808665-68808687 GGGGCTAGGCAGTCGCCGCCAGG + Intronic
1101504002 12:105330492-105330514 GGGGCGTGGCCGGCGCAGCGGGG - Intronic
1102822183 12:115917277-115917299 GGGGCTGGGCGGGCGGAGCGCGG + Intergenic
1103119831 12:118371978-118372000 GGGGCTGGGCTGAGACAGCGGGG - Intronic
1103813419 12:123633905-123633927 GGGGCTCGGCTGTCTCGGTCCGG + Intronic
1104724044 12:131065374-131065396 CGGGCCCTGCTGTAGCAGCGTGG + Intronic
1110573017 13:77026779-77026801 CCGGCTCCGCCGTCGCAGCGGGG + Intronic
1113055075 13:106259334-106259356 GGGGCTCGGATGCTGCTGCGGGG - Intergenic
1113662842 13:112118769-112118791 GGGGCTTGGCAGACCCAGCGGGG - Intergenic
1113801704 13:113089991-113090013 CGGGTCCGGCTGTCGCAGGGAGG - Intronic
1116426535 14:44798763-44798785 GGGTCTTAGCTGTCCCAGCGGGG + Intergenic
1119702027 14:76761947-76761969 ATGGCTCGGCTGGTGCAGCGCGG + Intergenic
1120881309 14:89417045-89417067 GGGGCGCGGGGGTCGCGGCGCGG + Intronic
1122886410 14:104712363-104712385 GGGGCTCCCCTGTCCCAGCGAGG + Intronic
1125879980 15:43185423-43185445 GTGGAGCGGCTGTCGCAGTGCGG + Exonic
1128095928 15:64955501-64955523 GGGGCTTGGCTGTACCAGCAGGG + Intronic
1132555421 16:569974-569996 GGGGCTCGGGTCCCGCGGCGGGG + Intronic
1132622587 16:874799-874821 GGCACTCGGCTGTCACAGCGCGG + Intronic
1132806650 16:1778077-1778099 GGGGCTGGGCTGCCGGAGCCAGG + Intronic
1132807637 16:1782423-1782445 CGGGCGCGGCGGTAGCAGCGCGG - Intronic
1132873337 16:2125065-2125087 ATGGCTCGGCTGGCCCAGCGAGG - Intronic
1133220182 16:4316309-4316331 GGGGCCCGCCTGTCGCGCCGGGG + Intronic
1133344698 16:5062107-5062129 GAGGCTGGGCTGTCCCAGAGGGG - Intronic
1134552425 16:15144244-15144266 ATGGCTCGGCTGGCCCAGCGAGG - Intergenic
1137617019 16:49854716-49854738 GGGGCTCTGCTGCCGGCGCGCGG + Intronic
1142231420 16:88901910-88901932 GGGGCACGGCTCTCGCAGGGCGG - Intronic
1142631441 17:1229008-1229030 GGGGGGCGGCGGCCGCAGCGGGG - Intronic
1142859995 17:2755650-2755672 GAGGCTCGGCTGCCGCAGGCGGG - Intergenic
1144565161 17:16353547-16353569 GGGGCGCGGCTGGCGGAGCGGGG - Intronic
1145728931 17:27157911-27157933 GTAGCTCTGCTGTGGCAGCGGGG - Intergenic
1148621522 17:49038302-49038324 AGGGCTCACCTGTGGCAGCGGGG + Exonic
1151703169 17:75753946-75753968 GGGGCCCGGGTGTCGCACTGCGG - Exonic
1152626740 17:81391086-81391108 GGGGCGCAGCGGGCGCAGCGCGG + Intergenic
1152705373 17:81840941-81840963 TGGGCTCGGCTGTGGCTGGGAGG - Intergenic
1158435927 18:57435624-57435646 GGGGCTCGGCTGCGGGAGTGGGG - Intergenic
1158548581 18:58416309-58416331 TGGGCTCAGCTGTCTCAGCATGG - Intergenic
1161367761 19:3890774-3890796 GGGGCCAGGCTGGCACAGCGAGG - Intronic
1162926569 19:13933231-13933253 GGGGCTCTGCGGCCGCTGCGGGG - Exonic
1163051853 19:14690189-14690211 AGGGCTCGGCTGGCGCGGGGAGG + Intronic
1163144779 19:15373054-15373076 GGGGCTCAGAGGACGCAGCGGGG + Exonic
1167048918 19:47067207-47067229 GGGGCCCTGCCGTGGCAGCGCGG + Exonic
1167093255 19:47359135-47359157 GGGGCTGGGCTGTCGGAGGAGGG + Intronic
1168654622 19:58118218-58118240 GGGGCTGGGCGGTGGCTGCGTGG - Intronic
929939771 2:46324618-46324640 GGGGCAAGGCTGTGGCAGCCTGG + Intronic
931514619 2:63040790-63040812 TGGGCTGGGCTGTCCCAGAGAGG + Intronic
932781277 2:74560158-74560180 GGAGCTCGGCTCTCCCAGTGTGG + Exonic
932798110 2:74715419-74715441 GGGGCGGGGCGGACGCAGCGCGG + Intergenic
935341215 2:102061414-102061436 GGGGCTCTGCTGTTGCAATGCGG + Intergenic
938302913 2:130229017-130229039 GGGGCCCCGCCGTCGCAGCCTGG + Intergenic
942928027 2:181457103-181457125 CGGGCTGGGCGGTCACAGCGAGG + Intergenic
1169211271 20:3767511-3767533 GGGGCTCCGCTGTCGGGGCCGGG - Intronic
1175892993 20:62323497-62323519 GGGGCACAGATCTCGCAGCGGGG + Exonic
1176385545 21:6137198-6137220 GGCTCTTGGCTGTCGCAGCAAGG + Intergenic
1178701167 21:34834969-34834991 GGGGCTATGCTGTGGCAGCCAGG + Intronic
1179511172 21:41874862-41874884 GGAGCTCGGCTTTCTCAGAGAGG - Intronic
1179737928 21:43401054-43401076 GGCTCTTGGCTGTCGCAGCAAGG - Intergenic
1181147348 22:20858509-20858531 GGGGCTGGGGTGACGAAGCGTGG - Intronic
1182511321 22:30822419-30822441 TGGGCTCGGCTCCCGCGGCGCGG + Intronic
1183310424 22:37106719-37106741 GGGTCTTGGATGTCGCAGCAAGG - Intronic
1184130622 22:42514652-42514674 GGGGCTCGGCCGACCCCGCGGGG + Intronic
1184140801 22:42576482-42576504 GGGGCTCGGCCGACCCCGCGGGG + Intergenic
1184801490 22:46762995-46763017 GGGGCTCGGAGGTCGGAGCGTGG + Intronic
1185221076 22:49629576-49629598 AGGGCTCGGCTGGAGCAGGGAGG + Intronic
1185321304 22:50201299-50201321 GAGGCGCGGCTGCCGCAGCGGGG - Exonic
952883366 3:37998818-37998840 GGAGCTCGGCTGTCCCAGAGCGG + Intronic
954778878 3:53045350-53045372 GGGGCTCGGCGGGCGGAGCGCGG + Intronic
956420363 3:69080425-69080447 GGGGCGGGGCTGGCGAAGCGGGG + Intergenic
961513718 3:127420124-127420146 GGGGCCTGGTTGTCGCAGGGAGG - Intergenic
968952676 4:3702846-3702868 GGGGCCCAGCTGTCCCTGCGGGG + Intergenic
969306231 4:6327715-6327737 GGGGCTGGGCTGGCACAGCTGGG - Intronic
971351944 4:25863009-25863031 GGCGCTCGGCTGGGGCTGCGGGG - Intronic
972418716 4:38867650-38867672 CGGGCCCGGCCCTCGCAGCGTGG + Intergenic
976600656 4:86935098-86935120 GGGGCTCGGCTGCGGAACCGCGG - Exonic
991611950 5:68458570-68458592 GGGGCTCGGATGTTGCTGCTGGG + Intergenic
992690485 5:79236474-79236496 GGAGCTCGGCGGTCGGGGCGCGG + Exonic
996379042 5:122845519-122845541 GGGGCCCCGCGGGCGCAGCGGGG + Exonic
997305068 5:132830633-132830655 GGGGCTCTGATGTCACCGCGCGG - Exonic
997467819 5:134099971-134099993 GGGGCCAGGCTGTACCAGCGAGG - Intergenic
1002021335 5:176365989-176366011 GAGGCTCGGGTGTTCCAGCGGGG + Intronic
1004582012 6:16963479-16963501 GGTGCTGGGATGTAGCAGCGAGG - Intergenic
1006502127 6:34465873-34465895 AGGGGTCGGCTGAAGCAGCGGGG + Intergenic
1006814172 6:36839577-36839599 GGGGCTCGGGTGACGCCGCGAGG + Exonic
1009808740 6:68635110-68635132 GAGGCTCGGCTCGCGCGGCGCGG - Intergenic
1010691000 6:78910852-78910874 GGTGCGCGGCTGTCCCAGCACGG - Intronic
1018619226 6:165714542-165714564 GGGGCTGGGCTGGGGCAGCCAGG + Intronic
1019298405 7:290840-290862 GGGCCCCGGGTGTCCCAGCGTGG + Intergenic
1019562209 7:1664719-1664741 GGGGCGCGGCGCTGGCAGCGGGG + Intergenic
1020073130 7:5240459-5240481 GGGGCTGGGCGGTCGCACCCGGG + Intergenic
1023349857 7:39309472-39309494 GGGGATCGGCTGTCCCAGCCAGG - Intronic
1024043764 7:45574279-45574301 GGGGCTCGGCTGTCGCAGCGCGG + Intronic
1025738981 7:64181715-64181737 CCGGCTCGGCTGTCGCGGCCCGG - Intronic
1026360406 7:69597960-69597982 GGATCCCGCCTGTCGCAGCGGGG - Intergenic
1026994608 7:74607126-74607148 GGGGCTGGGCGGGCGCAGGGTGG - Intergenic
1027385839 7:77659089-77659111 GGGGCTCAGCTGGCGCTGCTGGG + Intergenic
1027423606 7:78040601-78040623 GGGGCTCAGCTCTGGAAGCGCGG + Intronic
1028985252 7:97004167-97004189 GGGGCTCCGCTGTCTCTGCTTGG + Intergenic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1036032934 8:4992586-4992608 GGGGCGTGTGTGTCGCAGCGGGG - Intronic
1038008727 8:23457362-23457384 GGCGCTCGGATGTGGCCGCGCGG + Intronic
1039921503 8:41896908-41896930 GGGGCCCGGCCGGCGCGGCGAGG + Intergenic
1040296452 8:46151527-46151549 GGTGCTCGGCTTTCCCAGGGAGG - Intergenic
1040319584 8:46285897-46285919 GGGGCTGGGTTGTCCCAGGGAGG - Intergenic
1043520053 8:81035067-81035089 GGGGCCCAGCTATCGCAGGGAGG + Intronic
1049658642 8:143809920-143809942 GGGGCTGGGCTGTGGAACCGTGG - Intronic
1049697175 8:143990062-143990084 GCGGCTCGGAAGACGCAGCGGGG - Exonic
1053022001 9:34701487-34701509 GGGGCGCGGCTGCGGCAGAGGGG + Intergenic
1053199290 9:36141940-36141962 GGGGCTGGGCTGTCTCTGCTGGG - Intronic
1061521489 9:131120838-131120860 GGGGATCAGCTGGGGCAGCGGGG - Exonic
1062468573 9:136692184-136692206 GGGGCTTGGCTCTTGCAGGGTGG + Intergenic
1203794660 EBV:169976-169998 GGGGCTTGGCTGGCGCGGCCGGG - Intergenic
1203794861 EBV:170514-170536 GGGGCTTGGCTGGCGCGGCCGGG - Intergenic
1203795052 EBV:171037-171059 GGGGCTTGGCTGGCGCGGCCGGG - Intergenic
1203795253 EBV:171575-171597 GGGGCTTGGCTGGCGCGGCCGGG - Intergenic
1187950517 X:24465696-24465718 GGGGCTCGGATTTCGGGGCGCGG + Intronic