ID: 1024043981

View in Genome Browser
Species Human (GRCh38)
Location 7:45575071-45575093
Sequence GCTGCCCGTGCGCAGCCTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 217}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024043977_1024043981 7 Left 1024043977 7:45575041-45575063 CCTTTTGGTCACCTTCGTGTCCT 0: 1
1: 0
2: 2
3: 10
4: 144
Right 1024043981 7:45575071-45575093 GCTGCCCGTGCGCAGCCTGCTGG 0: 1
1: 0
2: 1
3: 27
4: 217
1024043975_1024043981 29 Left 1024043975 7:45575019-45575041 CCGAACAAGGGGTTTGGCAGCTC 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1024043981 7:45575071-45575093 GCTGCCCGTGCGCAGCCTGCTGG 0: 1
1: 0
2: 1
3: 27
4: 217
1024043978_1024043981 -4 Left 1024043978 7:45575052-45575074 CCTTCGTGTCCTATGCCTTGCTG 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1024043981 7:45575071-45575093 GCTGCCCGTGCGCAGCCTGCTGG 0: 1
1: 0
2: 1
3: 27
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024043981 Original CRISPR GCTGCCCGTGCGCAGCCTGC TGG Exonic
900411335 1:2514055-2514077 CCTGACCGTGCGCAGCCTGCTGG - Exonic
900599878 1:3498393-3498415 GCTGCCTCTGCCCAGCCGGCTGG - Exonic
901469253 1:9444248-9444270 CCTGCCTGTGCTCATCCTGCAGG - Intergenic
901616186 1:10541528-10541550 GCTGCTCGTGCGGAGCAGGCAGG + Intronic
901791551 1:11655859-11655881 GCTGCCCGAGAACATCCTGCTGG + Exonic
901793784 1:11668703-11668725 GCTGCCCGAGAACATCCTGCTGG + Exonic
903327960 1:22582133-22582155 ACTGCCCCTGCCCAGCCTGAGGG + Intronic
904614077 1:31740466-31740488 GCAGGTGGTGCGCAGCCTGCAGG - Exonic
906322607 1:44826547-44826569 GCTGGCCGTCTGCATCCTGCTGG - Exonic
908224651 1:62043930-62043952 GTTGCCCATGCCCAGTCTGCTGG + Intronic
908745634 1:67373842-67373864 GCTGCCAGAGAGCTGCCTGCAGG + Intronic
912386736 1:109274565-109274587 CCTGCCCGGGTGCAGCCTGAAGG - Exonic
914858518 1:151369156-151369178 GCTGCCCATGCCCAACCTGAAGG - Exonic
915636481 1:157190437-157190459 GATGCCCGAGAGCAGCCCGCTGG + Intergenic
916729466 1:167553387-167553409 GCTCTCCGTGAGCAACCTGCAGG - Exonic
916794085 1:168149781-168149803 GCGGCCTGTGCCCAGCCTCCTGG - Intergenic
919528165 1:198679982-198680004 GCTGCCCGTCCACTTCCTGCAGG + Intronic
922774374 1:228208069-228208091 GCTGCTGGTAGGCAGCCTGCTGG + Intronic
1062799633 10:369518-369540 GCTGTCCGTGCTCACCGTGCAGG - Exonic
1065526097 10:26622560-26622582 CCTGCCCGTCCGCAGCCAGTGGG - Intergenic
1065596649 10:27319823-27319845 CCCGCCCGTCCGCAGCCAGCGGG + Intergenic
1065784329 10:29199500-29199522 GCTGCCCATCCCCAGCCGGCAGG + Intergenic
1066013693 10:31217255-31217277 GCGGCCCGTGAGCACCCTGCAGG - Intergenic
1069617939 10:69818095-69818117 GCTGCCCATGCCTACCCTGCTGG + Intronic
1069683350 10:70300684-70300706 GCTCCCCATTCCCAGCCTGCTGG + Exonic
1073042370 10:100616217-100616239 ACAGCACGGGCGCAGCCTGCAGG + Intergenic
1073051009 10:100667505-100667527 CCTGCCCTTGCGGAGCCTTCGGG + Intergenic
1073325912 10:102643984-102644006 GCTGGCCGGGCGCGGGCTGCGGG - Intergenic
1073718695 10:106139979-106140001 GATGCCCATGCAGAGCCTGCTGG + Intergenic
1074055998 10:109923365-109923387 GCTGCCCGGACGCCGGCTGCCGG + Intronic
1074814519 10:117134367-117134389 GCTGCGCGGGCCCAGCTTGCCGG - Exonic
1075116452 10:119630959-119630981 GGTGCCTGTCCTCAGCCTGCTGG - Intergenic
1076895522 10:133309383-133309405 GCTGCACGTCCCCATCCTGCAGG - Exonic
1076978038 11:190110-190132 GGTGCCCGTACGCCGCCTGCTGG + Intronic
1076980048 11:199441-199463 GCTGCCCGTGTGGAGCCCCCAGG + Exonic
1077158098 11:1100373-1100395 GCTGCCAGTGAGGTGCCTGCGGG + Intergenic
1077516126 11:3003097-3003119 CCTGCCCGGGTGCTGCCTGCTGG - Intronic
1078466645 11:11554940-11554962 GCTGGTCCTGCGCAGCCTCCTGG + Intronic
1080824717 11:35838003-35838025 TCTGCCCGTCCCCAGCCAGCCGG - Intergenic
1083085582 11:60140790-60140812 GCTGCCTGTGCTCTTCCTGCTGG + Intergenic
1083682782 11:64359032-64359054 GCTGCCGGTGGGCGGCCGGCTGG - Intergenic
1084064237 11:66694171-66694193 GCTGCTCGCGAGAAGCCTGCAGG + Exonic
1084378899 11:68798180-68798202 GCTGTCCCTTCACAGCCTGCTGG + Intronic
1084546836 11:69818897-69818919 GCTGCTACTGCTCAGCCTGCTGG - Exonic
1084608960 11:70188679-70188701 GCTGACAGTGGGGAGCCTGCTGG - Exonic
1085477939 11:76799384-76799406 CCTGCCCGTGCGGAGGCTCCCGG + Intergenic
1089140925 11:116283293-116283315 GTTGCCAGTGCTCAGCCTGCAGG + Intergenic
1089273212 11:117315693-117315715 GCTGCCCCTGCGCAGCGGCCTGG - Exonic
1089531707 11:119134198-119134220 GCTGAACGAGAGCAGCCTGCAGG + Exonic
1092508424 12:9127731-9127753 GGTGCCCGTCAGCAGCCTGTCGG - Intergenic
1094525325 12:31227318-31227340 CCTGCCTCTGCGCAGACTGCTGG + Intergenic
1100309236 12:93378493-93378515 CCCGCCCCTGCGCAGGCTGCGGG + Intronic
1101479609 12:105084419-105084441 GCTGCCCCGCCGCAGCATGCTGG + Exonic
1101479688 12:105084690-105084712 GCTGTCCGAACGCAGCCAGCTGG - Intergenic
1101997222 12:109533941-109533963 CCTGGACGTGCACAGCCTGCTGG - Intronic
1102119847 12:110431523-110431545 GTGGCCCGTGCGCCCCCTGCTGG + Intergenic
1103723691 12:122987666-122987688 CCAGCCCGTGACCAGCCTGCTGG - Intronic
1104676604 12:130715672-130715694 GATTCCTGGGCGCAGCCTGCGGG + Intronic
1104720666 12:131043532-131043554 CCTGCCCACACGCAGCCTGCAGG - Intronic
1104953734 12:132453917-132453939 GGTGCCCGGGCTCAGCCTGCAGG + Intergenic
1105011926 12:132761871-132761893 GCTGCCCGCGCCCTGCCTGACGG + Exonic
1106081155 13:26501214-26501236 GCTGCATGTGGGCAGCCTGCAGG - Intergenic
1106370665 13:29129735-29129757 ACTGCCTGTGCCCAGCATGCTGG + Intronic
1112656106 13:101453885-101453907 GCTGGCCGGGCGCCGCCTGCAGG + Exonic
1114182609 14:20378790-20378812 GCTGCCTGAGCCCAGACTGCCGG - Exonic
1115713201 14:36073083-36073105 GCTGCTGGTGTGCGGCCTGCTGG + Intergenic
1118632888 14:67722435-67722457 GCTGTCAGAGCACAGCCTGCTGG - Exonic
1121595290 14:95157473-95157495 GCGGGCCGTGCGCTGGCTGCCGG - Intronic
1122392808 14:101401905-101401927 GCTGCCTGTGCCTGGCCTGCAGG - Intergenic
1122898970 14:104774274-104774296 GCTGCCGGGGCCCAGCCTGATGG - Intronic
1125690410 15:41591577-41591599 GCAGCCCATGCCCAGTCTGCTGG - Intergenic
1125720249 15:41841900-41841922 GCTTCCACTGCCCAGCCTGCTGG + Exonic
1126134565 15:45378106-45378128 TCTGCGCGTCCGCGGCCTGCTGG - Intronic
1126849175 15:52787195-52787217 GGTTCCCGGGCGCAGGCTGCAGG + Intronic
1128103938 15:65029343-65029365 GCCGCCCGGGCGCGGCCTGGAGG + Intronic
1128251004 15:66164355-66164377 GCTGCACGTGAGGGGCCTGCTGG + Intronic
1128359827 15:66954140-66954162 GGTGCCTGTGCTCAGCCTGTTGG - Intergenic
1129242689 15:74260966-74260988 GCTAACGGTGCCCAGCCTGCAGG - Intronic
1130223691 15:82043126-82043148 GCTGCTAGTGCGCACCGTGCTGG - Exonic
1131691304 15:94830696-94830718 GCTAGCTGAGCGCAGCCTGCTGG + Intergenic
1132393130 15:101453340-101453362 GCTGCACAGGGGCAGCCTGCGGG - Intronic
1132549752 16:549481-549503 GCCGCCCGTGCCCACCCTGCAGG - Intronic
1133137991 16:3725532-3725554 GCTGCCACTGCTCGGCCTGCTGG - Exonic
1134212565 16:12289933-12289955 GCTGCATGAGCTCAGCCTGCAGG + Intronic
1136156108 16:28383331-28383353 CCTGCTGCTGCGCAGCCTGCAGG - Exonic
1136206978 16:28731957-28731979 CCTGCTGCTGCGCAGCCTGCAGG + Exonic
1136590863 16:31216890-31216912 GCTGCCCGAGCGCGCCCCGCGGG + Exonic
1138387771 16:56647994-56648016 GCTGCCAGTGCGCACCCTGGGGG - Intronic
1138454461 16:57113451-57113473 GCTCACCGTGCCCAGGCTGCAGG - Exonic
1139761473 16:69187496-69187518 GCCGCCCGTGCGCCGGGTGCGGG + Exonic
1142172050 16:88628041-88628063 GCTGCCCGGGGGGTGCCTGCTGG - Exonic
1142229794 16:88894900-88894922 GCTCCCCCTGGGCAGCCGGCAGG + Intronic
1142465463 17:134575-134597 GGTGCCCGTACGCCGCCTGCTGG + Intergenic
1142685669 17:1575732-1575754 GCTGCTCCTTCTCAGCCTGCTGG - Exonic
1143538667 17:7557158-7557180 GCTGGCCCTGCGCTGCCTGGAGG + Exonic
1144885083 17:18452258-18452280 GCTGTCCTTGTGCAGCCTCCAGG + Intergenic
1147188280 17:38724706-38724728 GCTGCCCATGGCCAGCCTGCTGG + Exonic
1149759978 17:59220448-59220470 GCTGCGCGTGCGCAGTAGGCCGG + Intronic
1150124680 17:62628275-62628297 GCTCCCCGGGCGCGCCCTGCAGG - Intronic
1151395692 17:73821241-73821263 GCTTCCAATGCCCAGCCTGCAGG + Intergenic
1151684296 17:75637723-75637745 GCTGGCCGAGCACAGCCAGCTGG + Exonic
1151692903 17:75697893-75697915 GCTGGCTGTGCGAAGCCAGCCGG + Intronic
1152034760 17:77865355-77865377 GCTGCTCCTACGCAGGCTGCTGG - Intergenic
1152111368 17:78359359-78359381 GCTGCCCGGGGCCACCCTGCCGG - Intronic
1152422986 17:80204046-80204068 GCAGCCCCTGCCCAGCCTGCAGG + Intronic
1152457976 17:80426955-80426977 GCTGCCCCAGGGCAGGCTGCAGG - Intronic
1152791615 17:82283242-82283264 GCGGCCCTGGCCCAGCCTGCAGG + Intergenic
1154218579 18:12433204-12433226 GCTGCTCGTGCGCAGGGTCCGGG + Intergenic
1156397020 18:36707673-36707695 AATGCCCATGCCCAGCCTGCTGG + Intronic
1158435711 18:57434736-57434758 GCCGCCCGTGGGCCGCCGGCCGG + Intergenic
1158941656 18:62410473-62410495 CCTGCCCATGCACAGCCTGAAGG - Intergenic
1160717110 19:581467-581489 GCTCCGCGTGCGCAGCCACCTGG + Exonic
1160854841 19:1212110-1212132 GCTTCCGGTGCCCAGCCAGCTGG + Intronic
1160893090 19:1389695-1389717 GCTGCACGTGCTCACGCTGCAGG - Intronic
1161220519 19:3116067-3116089 GCTGCCCCTGCGGATCCTGCTGG + Intronic
1161479828 19:4504914-4504936 GCTGCCCTTCTGGAGCCTGCTGG + Exonic
1161495746 19:4584762-4584784 GCTGCCCGTTCGGAGCCCCCAGG - Intergenic
1161811332 19:6472900-6472922 GCTGCAGGTGCACAGCCCGCCGG + Exonic
1162028872 19:7908985-7909007 GCTGCCCGCATGCAGGCTGCTGG + Intronic
1162951307 19:14073426-14073448 GCGGCCGGTGCTCAACCTGCCGG + Exonic
1163019304 19:14474077-14474099 GCTGTTCGTGGCCAGCCTGCTGG - Exonic
1163632031 19:18422381-18422403 GCTGCCAGTGGGGAGGCTGCAGG + Intronic
1163732945 19:18960601-18960623 TCTGCCCCTGCCCAACCTGCTGG + Intergenic
1164098444 19:22032732-22032754 GCTGCCTGTGGGCAGCATGAAGG + Intergenic
1167149771 19:47701945-47701967 CCTCCCCGTGCCCTGCCTGCGGG - Exonic
925319117 2:2948602-2948624 GCTCCCCTTGCCTAGCCTGCAGG - Intergenic
926242885 2:11101629-11101651 CCTGCCCCTGGGCAGCCTGGTGG - Intergenic
926778827 2:16448411-16448433 GCTTCCTCTGCTCAGCCTGCTGG - Intergenic
927591310 2:24360360-24360382 CCTGCCCGCGCCCAGGCTGCCGG - Exonic
927606600 2:24491614-24491636 GCTGCGGGTGCGGAGCCTCCCGG + Intergenic
928275738 2:29898635-29898657 GCTGCCCGAGCTCAGCCATCAGG - Intronic
930712214 2:54559640-54559662 GCTGTCCCTGCCCAGCCAGCAGG + Intronic
930946862 2:57085145-57085167 CCTGCCCTTGCTCAGCCTGGCGG - Intergenic
932203719 2:69858170-69858192 CCTGCCCCTCCCCAGCCTGCAGG - Intronic
932576517 2:72965221-72965243 TCTGCCCGTGGGTGGCCTGCCGG - Intronic
935854037 2:107255929-107255951 GCTGCCTCTGCGCCTCCTGCTGG - Intergenic
936412799 2:112275518-112275540 GCGGCCCTTGCCCAGCCCGCCGG - Intergenic
937570087 2:123346904-123346926 GGTGCCCATACCCAGCCTGCTGG + Intergenic
938100238 2:128493369-128493391 GCGGCCCGGCCGCGGCCTGCTGG - Intergenic
938341841 2:130541148-130541170 GCTGCCCGTGCCCAGCGTGGGGG + Intronic
938347989 2:130579563-130579585 GCTGCCCGTGCCCAGCGTGGGGG - Intronic
941717273 2:168777216-168777238 GCTGACAGTGCGGAGCCTGGGGG + Intergenic
943224101 2:185145754-185145776 ACTGCCTGAACGCAGCCTGCCGG + Intergenic
943580096 2:189674519-189674541 GCTCCTCGGGCGGAGCCTGCGGG - Intronic
946249270 2:218402901-218402923 GCTGGCCAAGCGGAGCCTGCGGG + Intronic
946285403 2:218698877-218698899 TCGGCCCCTGCGCAGCCTCCTGG + Exonic
946351853 2:219160546-219160568 GCCGCGCGTGCGCAGTCCGCTGG - Intronic
948436094 2:237955704-237955726 GCTGCCGGTGCTCAGCCTTCAGG + Intergenic
948789853 2:240371593-240371615 CCTGCCCCTCGGCAGCCTGCAGG - Intergenic
948889323 2:240899225-240899247 CCTGCCAGGGCGCTGCCTGCAGG + Intergenic
1171215713 20:23350806-23350828 GCTTCCCGCGCGCGGCCAGCCGG - Exonic
1171459208 20:25289112-25289134 GGTGCCTGTGTGCAGCCTGAAGG + Intronic
1172684812 20:36745815-36745837 GCTCCCCGCGCCCAGCCCGCCGG - Intronic
1172872639 20:38145189-38145211 GCTGCCCTGACCCAGCCTGCTGG + Intronic
1174317453 20:49713739-49713761 GCTCCCCGTCCGCCGCCTCCTGG + Exonic
1174342810 20:49908377-49908399 GCTGCCAGGCCGCTGCCTGCTGG + Exonic
1175385755 20:58594033-58594055 GCTGCCCATGCCCAGGCTGCTGG + Intergenic
1175524559 20:59624555-59624577 GCTGCTCCTGTGTAGCCTGCAGG + Intronic
1175758869 20:61547697-61547719 GCTGCTCCTGCGCTGTCTGCAGG - Intronic
1175972850 20:62695648-62695670 GCTGCCCATCCGGAGCCTCCTGG - Intergenic
1176201451 20:63862646-63862668 GCTGCCAGCGCGCAGCCAGCGGG - Exonic
1176215146 20:63944402-63944424 GCAGCACGTGCACAGCCAGCTGG - Exonic
1176233737 20:64044758-64044780 TCTGCCCCTGGGCTGCCTGCTGG + Intronic
1176306909 21:5128438-5128460 ACTGCGCCTGCGCAGCCTTCGGG + Exonic
1176378950 21:6102153-6102175 GCCCCCCCTGTGCAGCCTGCAGG + Intergenic
1178849365 21:36200424-36200446 GCTGCTCCTGCCCAGTCTGCAGG + Exonic
1178876921 21:36420809-36420831 CCTGCCTGTGCGCAGCCTCTGGG + Intergenic
1179744524 21:43436084-43436106 GCCCCCCCTGTGCAGCCTGCAGG - Intergenic
1179850150 21:44133592-44133614 ACTGCGCCTGCGCAGCCTTCTGG - Exonic
1180009953 21:45042950-45042972 GCTGCCCTTGGGCAGCCTCGGGG - Intergenic
1180009957 21:45042957-45042979 GCTGCCCAAGGGCAGCCTGGAGG + Intergenic
1180791784 22:18578616-18578638 GCTGGCTGAGCGCAGCGTGCTGG - Intergenic
1180871666 22:19150178-19150200 CCTGCCCGAGCGGAGCCTCCCGG - Exonic
1181050441 22:20235819-20235841 GCTGCCGGTTGGTAGCCTGCCGG - Intergenic
1181229952 22:21416693-21416715 GCTGGCTGAGCGCAGCGTGCTGG + Intergenic
1181248697 22:21518173-21518195 GCTGGCTGAGCGCAGCGTGCTGG - Intergenic
1181863699 22:25839355-25839377 CCTGGCCGTGCTCACCCTGCAGG + Intronic
1183217290 22:36489331-36489353 GCTGCTCGAGATCAGCCTGCTGG + Exonic
1183672058 22:39278750-39278772 GTTGCCCGTGGGTAGCCTGCGGG - Intergenic
1184504631 22:44893394-44893416 GCTCCCAGTGCACAGCCTCCAGG - Intronic
953899298 3:46830265-46830287 GCTGCCCCTGGGCATCCTGGTGG - Intronic
954444739 3:50540592-50540614 GCAGCCCCTGCACAGTCTGCAGG - Intergenic
960939164 3:122922390-122922412 CCTGACGGAGCGCAGCCTGCAGG - Exonic
961447710 3:126988599-126988621 GCTGCCACCGCGGAGCCTGCAGG + Exonic
968488398 4:876356-876378 GCTGCGCGTGTGTAGGCTGCTGG - Intronic
968497175 4:925263-925285 GGTGCCCCCGAGCAGCCTGCAGG + Intronic
968922128 4:3527718-3527740 ACTGCCCATGGGCTGCCTGCTGG + Intronic
969580385 4:8061276-8061298 GCTGCACTTGCCCAGCCTGCAGG + Intronic
969638542 4:8383208-8383230 CCTGCCTGTGCCCTGCCTGCGGG - Intronic
974032471 4:56788198-56788220 GCTGATCGTGGGCAGACTGCTGG - Intergenic
977145030 4:93429061-93429083 GCTGCCCGTGCCCTAGCTGCTGG + Intronic
992149884 5:73892426-73892448 TCTGCCTGTGTGCACCCTGCCGG + Intronic
992157732 5:73971542-73971564 GCGGCTCCTGCGCAGGCTGCAGG - Intergenic
997302258 5:132814275-132814297 GCTGCCGGTGCGCTGCGTCCCGG + Exonic
998252095 5:140560364-140560386 GCTTCCAGTGCGCAGCCTTCTGG - Exonic
999697601 5:154200249-154200271 GCTGCCCGAGTGCAGCATCCAGG - Intronic
1002286454 5:178165719-178165741 GCTGCCGGGGCTCAGGCTGCTGG + Intergenic
1002332496 5:178454385-178454407 GCTGACAGCACGCAGCCTGCAGG - Intronic
1006599012 6:35213709-35213731 GCTGCCGGGCCGCTGCCTGCAGG - Intergenic
1007398515 6:41590506-41590528 GCTGACAGGGCCCAGCCTGCAGG - Intronic
1017039417 6:150295738-150295760 TCTGCCCTTCCGCAGCCTGCAGG + Intergenic
1019173803 6:170149636-170149658 GCTGCCCCTCCACTGCCTGCAGG + Intergenic
1019321187 7:416054-416076 TCTGCTCCTGGGCAGCCTGCGGG - Intergenic
1019453654 7:1113372-1113394 GCTGCCCGGGCGGCGCCTTCTGG - Intronic
1019465001 7:1183058-1183080 ACTGCCGATGCGCAGCCTTCTGG + Intergenic
1019780037 7:2934369-2934391 GCTGCCCCATCGCCGCCTGCAGG + Intronic
1020116164 7:5477778-5477800 GCTGCCACAGCGCTGCCTGCTGG + Intronic
1023416383 7:39937032-39937054 CATGCCCGTGCACAGGCTGCTGG - Intergenic
1024043900 7:45574735-45574757 GCTGGCCGTTCTCAGCCTGCTGG + Exonic
1024043981 7:45575071-45575093 GCTGCCCGTGCGCAGCCTGCTGG + Exonic
1024254789 7:47532263-47532285 GCAGCCCGTCCCCAGCCTACAGG - Intronic
1024316866 7:48028233-48028255 CCTGCCCATGTGCTGCCTGCTGG - Intronic
1025130986 7:56374192-56374214 GCAGGCCGTACGCAGGCTGCCGG - Intergenic
1026765002 7:73154869-73154891 GCGGCCCGCGCGCGGCCTGCCGG - Intergenic
1027041476 7:74964626-74964648 GCGGCCCGCGCGCGGCCTGCCGG - Intergenic
1027082166 7:75237743-75237765 GCGGCCCGCGCGCGGCCTGCCGG + Intergenic
1032227393 7:130043691-130043713 GCTGCCTCTTCGCAGCCTCCTGG - Intronic
1035018544 7:155787335-155787357 GCTGTCCCTGCGCTGCCTCCTGG - Intergenic
1035127225 7:156617012-156617034 GCTGCCCTTGCGGAGGCCGCGGG - Intergenic
1035566317 8:643543-643565 GCTGCCAGGGCCCAGCCGGCAGG - Intronic
1037450694 8:19013712-19013734 GCGGCCCGCGCGCACCCTGGCGG + Intronic
1037882219 8:22578939-22578961 GCTGGACGGTCGCAGCCTGCAGG + Exonic
1041133242 8:54726146-54726168 GCCACCCATGCACAGCCTGCTGG + Intergenic
1041186972 8:55311079-55311101 GCTGCCTGAGGGCAGCCTTCTGG + Intronic
1044079085 8:87861758-87861780 TCTGCCTGTTCTCAGCCTGCTGG + Intergenic
1046383216 8:113476546-113476568 GCTACCTGTGTCCAGCCTGCAGG - Intergenic
1047298936 8:123596470-123596492 CCCGCCCGAGAGCAGCCTGCTGG + Intergenic
1047382059 8:124372763-124372785 GCTGCGCAGGCGCAGTCTGCAGG + Intergenic
1048833348 8:138496947-138496969 GCTGCCCGGCCGCGGCCTCCGGG + Intergenic
1049336364 8:142088831-142088853 GCTGCCTGTGTGCAGACTGTGGG - Intergenic
1049579533 8:143405025-143405047 GCTGCCCCTACGCTTCCTGCAGG + Intergenic
1049828587 8:144685685-144685707 GCGGCCCGCGCGCAGCCGGCCGG - Intergenic
1051338871 9:16092900-16092922 GCTGGCCCTGTGCAGCCTGGTGG + Intergenic
1057192739 9:93096438-93096460 GCTGCCCAGGCGCGGCCTGCAGG - Intronic
1060192274 9:121600429-121600451 GCTTCCAGTGCTCAGCCTGGTGG + Intronic
1061052176 9:128203435-128203457 GCAGCCGGATCGCAGCCTGCGGG + Exonic
1061662796 9:132141469-132141491 GCTGCCCGGGCGCAGGCGTCTGG - Intergenic
1062021035 9:134319543-134319565 GCCTCCCCTGCGAAGCCTGCCGG - Intronic
1062514178 9:136924012-136924034 GCGGCCCTAGCGAAGCCTGCAGG - Intronic
1062580573 9:137227574-137227596 TCTGCCCGTCTGCAGCCTCCAGG - Exonic
1185460665 X:331572-331594 GCGGCCCGTGGGCACCGTGCTGG + Intergenic
1185877562 X:3713112-3713134 GCCGCCTGTGTACAGCCTGCAGG - Exonic
1189264345 X:39702267-39702289 GGTGGACGTGAGCAGCCTGCTGG - Intergenic
1197149468 X:123204284-123204306 GCAGCCTGTGGGCATCCTGCAGG + Intronic
1199672855 X:150161392-150161414 GCTGACAGTGTGCTGCCTGCTGG - Intergenic
1200056879 X:153466193-153466215 GCTGGCAGAGCCCAGCCTGCTGG - Intronic