ID: 1024045089

View in Genome Browser
Species Human (GRCh38)
Location 7:45580429-45580451
Sequence GCCTGGCACCTAAACACCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 50}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024045089_1024045102 27 Left 1024045089 7:45580429-45580451 CCCACGGTGTTTAGGTGCCAGGC 0: 1
1: 0
2: 0
3: 6
4: 50
Right 1024045102 7:45580479-45580501 AATAAGACCTCCCTTCCTCTGGG No data
1024045089_1024045096 -6 Left 1024045089 7:45580429-45580451 CCCACGGTGTTTAGGTGCCAGGC 0: 1
1: 0
2: 0
3: 6
4: 50
Right 1024045096 7:45580446-45580468 CCAGGCTTGAGCACGGGGCTGGG No data
1024045089_1024045097 -5 Left 1024045089 7:45580429-45580451 CCCACGGTGTTTAGGTGCCAGGC 0: 1
1: 0
2: 0
3: 6
4: 50
Right 1024045097 7:45580447-45580469 CAGGCTTGAGCACGGGGCTGGGG No data
1024045089_1024045094 -7 Left 1024045089 7:45580429-45580451 CCCACGGTGTTTAGGTGCCAGGC 0: 1
1: 0
2: 0
3: 6
4: 50
Right 1024045094 7:45580445-45580467 GCCAGGCTTGAGCACGGGGCTGG No data
1024045089_1024045099 2 Left 1024045089 7:45580429-45580451 CCCACGGTGTTTAGGTGCCAGGC 0: 1
1: 0
2: 0
3: 6
4: 50
Right 1024045099 7:45580454-45580476 GAGCACGGGGCTGGGGTACCGGG No data
1024045089_1024045098 1 Left 1024045089 7:45580429-45580451 CCCACGGTGTTTAGGTGCCAGGC 0: 1
1: 0
2: 0
3: 6
4: 50
Right 1024045098 7:45580453-45580475 TGAGCACGGGGCTGGGGTACCGG No data
1024045089_1024045101 26 Left 1024045089 7:45580429-45580451 CCCACGGTGTTTAGGTGCCAGGC 0: 1
1: 0
2: 0
3: 6
4: 50
Right 1024045101 7:45580478-45580500 GAATAAGACCTCCCTTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024045089 Original CRISPR GCCTGGCACCTAAACACCGT GGG (reversed) Intronic
900786392 1:4653242-4653264 GCCTGGCTCCTCAAGACCGTTGG + Intergenic
901088061 1:6624134-6624156 GCAAGGTACCTTAACACCGTGGG - Intergenic
901214054 1:7544434-7544456 GCCTGACTCCTCAACACCGGTGG - Intronic
905236690 1:36554876-36554898 GCCAGGCACCTGAAGATCGTGGG - Intergenic
916601642 1:166298910-166298932 GGCTGGCACCTGAAGACAGTGGG + Intergenic
1063262173 10:4401807-4401829 GCCTGGCCCCCAAACACAGATGG - Intergenic
1083817547 11:65144173-65144195 GCCTGGGGCCTGAACACAGTAGG - Intergenic
1091839140 12:3606888-3606910 GCCTGGTACATAAACACAGTAGG - Intronic
1091862235 12:3796102-3796124 GCCCAGCACCTAGACACAGTGGG - Intronic
1095358129 12:41301762-41301784 GCCTGGCACCAAAATACGGATGG + Intronic
1099959159 12:89380294-89380316 TCCTGGCTCCTAAACTCCATGGG - Intergenic
1104876013 12:132035359-132035381 ACCTGGCTGCTCAACACCGTGGG - Intronic
1110626546 13:77660971-77660993 GCCTGGCCCCCTTACACCGTGGG - Intergenic
1111673640 13:91359707-91359729 AACTGGCACTTAAATACCGTAGG - Intergenic
1120423302 14:84315658-84315680 TCCCTGCACCTTAACACCGTTGG + Intergenic
1121243198 14:92444380-92444402 GGCTGGCACCTAAGCCCCGTGGG + Intronic
1130898307 15:88187982-88188004 GCCAGGCACCTAAACCCTGTGGG + Intronic
1141755976 16:85991189-85991211 GCCTGGCTGCTAATCACCCTTGG - Intergenic
1146354335 17:32121207-32121229 GCCTGGCACCCAAAGTACGTGGG + Intergenic
1160075215 18:75667940-75667962 GCATTGCACCTAAAAACAGTGGG + Intergenic
1160791205 19:924650-924672 GCCTGTCATCTTAACACCTTGGG - Intergenic
1162871222 19:13588199-13588221 GCATGGCAGCTAATCACAGTGGG + Intronic
939518014 2:143193229-143193251 GCCTGGCACCTACACACTAAGGG + Intronic
943789733 2:191918586-191918608 GCCGGGCAGCCAAACACAGTTGG + Intergenic
947551510 2:231049998-231050020 GCCTGTCACCTCAACACTTTGGG - Intergenic
948156928 2:235790912-235790934 GCCTGGCACTTACACACCTGCGG - Intronic
1172239808 20:33405335-33405357 GACTGGGACTTAAACACCATTGG + Intergenic
1180965155 22:19784379-19784401 GCTTGGCACGTAGACACCGAGGG - Exonic
1183083294 22:35471031-35471053 GGCTGTCACCTAACCACTGTGGG - Intergenic
952924972 3:38314020-38314042 GCCGGCCACCTAGACACCCTGGG + Intronic
954422591 3:50426480-50426502 GCCTGGAAGCTCAACACCTTGGG - Intronic
955522512 3:59788506-59788528 GCCTGGCCCCTAACCACAGGAGG - Intronic
962198359 3:133381590-133381612 ACCTGGCACCAAGACACCGTAGG + Intronic
965607203 3:170509284-170509306 GCCTGTCCCCTAAACACAGGTGG - Intronic
977666497 4:99651179-99651201 GCCTGGCATGTAATCACCATGGG + Exonic
979565805 4:122152741-122152763 CCCTGGCACCTATAAACCGAGGG + Intronic
981952197 4:150422981-150423003 GCCTGTCACTTATACACCATTGG - Intronic
985349267 4:189040204-189040226 GACTGGCCCCATAACACCGTGGG - Intergenic
986344266 5:6819825-6819847 GCCTGGCAGCTTATCACTGTCGG + Intergenic
992747192 5:79831438-79831460 GCCTGGGACCTGCACGCCGTTGG - Intergenic
993844582 5:92924782-92924804 GCCTGATACCTAAACTCTGTAGG + Intergenic
999426025 5:151488379-151488401 GCCTGGCACCTGGATACCCTGGG + Exonic
1001595461 5:172895963-172895985 GCCTGGCACCTAAAGACACTGGG - Intronic
1002025419 5:176393299-176393321 TCCTGACACCTAAAGACCCTTGG + Intronic
1002327362 5:178418582-178418604 GCCTGGCACCCAAGCACCAGTGG - Intronic
1003992117 6:11496646-11496668 TCCTGGCCCATAGACACCGTGGG - Intergenic
1013961216 6:115902702-115902724 GCTTGGCACCCACACACTGTAGG + Intergenic
1017771184 6:157645652-157645674 GCCTGGAACCGAAACACCCCCGG - Intronic
1018833856 6:167468812-167468834 GCCTGCCACCTAAGCACAGGGGG + Intergenic
1020357029 7:7289158-7289180 GCCTGGGAGCTTAACACCTTGGG + Intergenic
1024045089 7:45580429-45580451 GCCTGGCACCTAAACACCGTGGG - Intronic
1033621007 7:143061947-143061969 GCCTGGCACCCCAACACAGGAGG - Intergenic
1036047408 8:5159434-5159456 CCCTGGCACCTGAACAGCATCGG + Intergenic
1044632563 8:94293331-94293353 GCCTGGCACCTAAAATCTGGGGG + Intergenic
1048570735 8:135653298-135653320 GCCTGGCACATAGACATAGTGGG + Intronic
1055930747 9:81557502-81557524 GGCTGGCATTTAAACACAGTTGG - Intergenic
1061837718 9:133340525-133340547 GCCTGGCACCAAAAGACACTGGG + Exonic