ID: 1024046223

View in Genome Browser
Species Human (GRCh38)
Location 7:45587432-45587454
Sequence CGGTGGGGTTAGAGAGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024046214_1024046223 22 Left 1024046214 7:45587387-45587409 CCTCACGGGGACTTTGACTACAG 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1024046223 7:45587432-45587454 CGGTGGGGTTAGAGAGAAGTTGG No data
1024046218_1024046223 -1 Left 1024046218 7:45587410-45587432 CCTGATTGTGGGTTGTGTCAGGC 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1024046223 7:45587432-45587454 CGGTGGGGTTAGAGAGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024046223 Original CRISPR CGGTGGGGTTAGAGAGAAGT TGG Intronic
No off target data available for this crispr