ID: 1024046223 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:45587432-45587454 |
| Sequence | CGGTGGGGTTAGAGAGAAGT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1024046214_1024046223 | 22 | Left | 1024046214 | 7:45587387-45587409 | CCTCACGGGGACTTTGACTACAG | 0: 1 1: 0 2: 0 3: 3 4: 53 |
||
| Right | 1024046223 | 7:45587432-45587454 | CGGTGGGGTTAGAGAGAAGTTGG | No data | ||||
| 1024046218_1024046223 | -1 | Left | 1024046218 | 7:45587410-45587432 | CCTGATTGTGGGTTGTGTCAGGC | 0: 1 1: 0 2: 0 3: 6 4: 83 |
||
| Right | 1024046223 | 7:45587432-45587454 | CGGTGGGGTTAGAGAGAAGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1024046223 | Original CRISPR | CGGTGGGGTTAGAGAGAAGT TGG | Intronic | ||
| No off target data available for this crispr | |||||