ID: 1024048611

View in Genome Browser
Species Human (GRCh38)
Location 7:45602038-45602060
Sequence AAGAGTGATCAGGGCTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 253}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024048603_1024048611 17 Left 1024048603 7:45601998-45602020 CCTTGACTGAACCGAATAGGGAC 0: 1
1: 0
2: 0
3: 0
4: 29
Right 1024048611 7:45602038-45602060 AAGAGTGATCAGGGCTTTGAGGG 0: 1
1: 0
2: 3
3: 20
4: 253
1024048606_1024048611 6 Left 1024048606 7:45602009-45602031 CCGAATAGGGACGTACTATGGGG 0: 1
1: 0
2: 1
3: 2
4: 40
Right 1024048611 7:45602038-45602060 AAGAGTGATCAGGGCTTTGAGGG 0: 1
1: 0
2: 3
3: 20
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024048611 Original CRISPR AAGAGTGATCAGGGCTTTGA GGG Intronic
900891137 1:5450637-5450659 AAGAGTAATCAGGAATTTCATGG + Intergenic
901283747 1:8059952-8059974 AGATTTGATCAGGGCTTTGAAGG + Intergenic
902508500 1:16953149-16953171 GGGAGTGATAAGGGCTATGACGG - Intronic
903779079 1:25810232-25810254 AGCAGAGATCAGGGCTCTGAGGG + Intronic
903958771 1:27043249-27043271 AACAGTGATAGGGGCTGTGAAGG + Intergenic
904989524 1:34580436-34580458 AATAGTGCTTAGGGCTATGAAGG - Intergenic
906510744 1:46409300-46409322 CAGAGTGCTCAGGCCTTTGTTGG - Intronic
906862116 1:49372562-49372584 AAGATTGAACTGGGCTTTAAAGG - Intronic
908566270 1:65359572-65359594 AAGGGTCCTCAGGGATTTGAGGG - Intronic
909674278 1:78221812-78221834 AAGAGTGGCCAATGCTTTGAAGG + Intergenic
910687159 1:89929160-89929182 CAGTGTGATAAGGGCTGTGATGG + Intronic
910694594 1:89998133-89998155 AATACTTATCAGGGCTTTAATGG + Exonic
911439968 1:97913777-97913799 AAAAGTGCTGGGGGCTTTGAGGG + Intronic
912619720 1:111142824-111142846 AAGTGTGATGAGTGCTTTAAAGG + Intronic
912725781 1:112057846-112057868 ATGAGTATCCAGGGCTTTGAAGG - Intergenic
915527860 1:156487213-156487235 GAGAGGGATCAGGGCTGAGAAGG + Intronic
915558029 1:156670772-156670794 AAGAGGGTTCAGGGCTTGGAAGG - Exonic
917185756 1:172353215-172353237 GAGAGTGATCTGGGTTTTGATGG - Intronic
917449494 1:175135181-175135203 AACTGTGATAAGGGCTATGAGGG - Intronic
919118635 1:193312634-193312656 AAGAGTTACGAGGGCTTTGTGGG + Intergenic
920126888 1:203700517-203700539 AAGTGTTATAAGGGCCTTGAAGG + Intronic
920569018 1:207002243-207002265 AAGAGTTCTCAGGGCTTTGATGG + Intergenic
921006754 1:211101147-211101169 CAGAGCCATAAGGGCTTTGATGG - Intronic
921246796 1:213251716-213251738 AAATGTGATGAGGGCTTTGGAGG + Intronic
923942905 1:238848783-238848805 AAGAAGGATTAGGGCTTAGAGGG - Intergenic
1063064843 10:2597781-2597803 AAAATTGAGCTGGGCTTTGAAGG - Intergenic
1064743209 10:18454145-18454167 TAGAGTGATGGGTGCTTTGATGG + Intronic
1065999992 10:31095716-31095738 AAGAATGATCACAGCATTGAGGG - Intergenic
1066494260 10:35926769-35926791 AAGAGTAATGAGGACTTTGAAGG + Intergenic
1066553499 10:36585510-36585532 AAAAAAGAACAGGGCTTTGAAGG + Intergenic
1067693648 10:48520238-48520260 CACAGTCATCAGGGCCTTGAGGG + Intronic
1068826677 10:61447881-61447903 ATGAGTGATCAGAACTCTGAAGG - Intronic
1070174327 10:73957326-73957348 AACAGTGAGCAGGGCTTGGCTGG - Intergenic
1071080349 10:81803025-81803047 AAGAGTAAGTTGGGCTTTGATGG + Intergenic
1071295735 10:84217948-84217970 AAGTGTGATCAGAGCTGGGAAGG + Intronic
1072050830 10:91701413-91701435 TAGTGTGATCAAGGCTATGATGG + Intergenic
1072380004 10:94858292-94858314 AGCAGTGATCAAGGCTTTGTGGG + Intergenic
1072434887 10:95405861-95405883 AACTGTGATAAGGGCCTTGATGG - Intronic
1074383335 10:112997616-112997638 AAGAGTGACCAGGGACCTGAGGG + Intronic
1077288277 11:1777330-1777352 ATGAGTGATCAGGGCTGAGCTGG + Intergenic
1078531300 11:12138829-12138851 AGGTTTGATCAGGGCTTTTATGG + Intronic
1078930468 11:15908591-15908613 AATTGTGATTAGGGCTGTGATGG + Intergenic
1081430437 11:42970833-42970855 AACAGTGATTAGGACTTTGGGGG + Intergenic
1081434418 11:43011223-43011245 AAGACTAAACAAGGCTTTGAGGG - Intergenic
1081542293 11:44044652-44044674 AAGAGTTATAAGGGCTTGTAGGG + Intergenic
1083273873 11:61586231-61586253 AAGGGTGGTGAGGGATTTGAGGG - Intergenic
1083652672 11:64212194-64212216 AAGAGTGAACAGGGCACAGAGGG - Intronic
1083737124 11:64687720-64687742 AAGACGGCTCAGGGCTGTGAGGG + Intronic
1084625981 11:70307525-70307547 AAGAGTGAACAGGGCTGAAAGGG + Intronic
1085023377 11:73222671-73222693 AAGAGGGAGGAGGGCTCTGAAGG - Intronic
1085035263 11:73296170-73296192 ACATATGATCAGGGCTTTGAAGG + Intronic
1087004288 11:93453901-93453923 AAGAGAGAGCAGGCTTTTGATGG - Intergenic
1087726316 11:101721071-101721093 AAGAGTCATCAGTGCTCTGGTGG + Intronic
1088378683 11:109169684-109169706 GAAAGTGACCAGGGCTTTGGGGG - Intergenic
1088456781 11:110041242-110041264 GAGAGTGATGAGGGCTCAGAGGG + Intergenic
1089287450 11:117416875-117416897 AAGGGGGATCAGGACTTTGAGGG - Intergenic
1089641986 11:119853777-119853799 AGGAGTGATGAGGGCTCTGCGGG - Intergenic
1090635586 11:128688649-128688671 AACAGTGGTCTGGGCTCTGAGGG + Intronic
1091576437 12:1740852-1740874 GAGAGTGATAAGGACTGTGAAGG + Intronic
1091912887 12:4245892-4245914 AAGCAGGCTCAGGGCTTTGATGG + Intergenic
1093081282 12:14814741-14814763 AAGACTGATCTGAGCTTTCAGGG - Intronic
1093812089 12:23503769-23503791 AAGACTAGTCCGGGCTTTGAGGG - Intergenic
1093905523 12:24687325-24687347 AAGGGTAATCAGGTGTTTGATGG - Intergenic
1095117498 12:38372436-38372458 AAGAGTGACCAAGGCTATAAGGG - Intergenic
1095593880 12:43937236-43937258 AAGAGTGAAAAGGGCTTAGTGGG + Intronic
1095729503 12:45491462-45491484 AGGAGAAATCAGGGGTTTGAGGG - Intergenic
1096374988 12:51101551-51101573 GATAGTGATAAGAGCTTTGAAGG - Intronic
1096408489 12:51360696-51360718 GAGAGTGAAGAGGGCTTTGGGGG - Intronic
1096446601 12:51698481-51698503 AAGAGTGCTCAGTGCTTTGTTGG + Intronic
1097826228 12:64177264-64177286 AATGGTGATCAGGGCTCCGAAGG + Intergenic
1100397669 12:94199020-94199042 CAGAGTAAACAGGGCTGTGAAGG + Intronic
1101709174 12:107248980-107249002 AAGAGTGGTAAAGGCTTGGAGGG - Intergenic
1102101714 12:110283256-110283278 AAGAATGATGACGGCTGTGATGG + Intronic
1108670673 13:52684883-52684905 AAGAGAGAGCAGGGGTTTGTTGG + Intronic
1109055846 13:57547419-57547441 AAGAGTGATCAGTGCCTGAAAGG + Intergenic
1109159486 13:58954762-58954784 AAGAGTAATAAGGAGTTTGAGGG - Intergenic
1113230672 13:108211265-108211287 AAGATTCATCACCGCTTTGATGG - Exonic
1113941974 13:114023154-114023176 GAGGGTGACCAGGGATTTGATGG + Intronic
1114983851 14:28200262-28200284 AAGAGTGATCAGAATATTGAGGG - Intergenic
1115112094 14:29836399-29836421 AAGAGTGGTCAGTGGTTTGCAGG + Intronic
1115774390 14:36699715-36699737 AACAGTGAGCAAGGCTTTGTGGG + Intronic
1117800576 14:59440333-59440355 CATAGTGAGCAGGGCTTCGATGG - Intronic
1119722333 14:76899651-76899673 AAGAGTGAGGAGGGCGGTGAAGG + Intergenic
1120687915 14:87559916-87559938 AAGATTGTGCAGGGCTTTGTAGG + Intergenic
1121094288 14:91205128-91205150 AAGAGTAATAAGAGCTTTGGGGG + Intronic
1129147336 15:73660559-73660581 AAAAATGAGCAGGACTTTGAAGG - Intergenic
1129233431 15:74209285-74209307 AAGCCTGCACAGGGCTTTGATGG + Intronic
1129378671 15:75151910-75151932 TAGAGGGATCAGGGCTGTTAGGG - Intergenic
1134060104 16:11194462-11194484 AGGCTTGAGCAGGGCTTTGAAGG - Intergenic
1134418103 16:14062007-14062029 GAGAGTGGCCAGGGCTTTGTGGG + Intergenic
1134628413 16:15739431-15739453 CATGGTGATCAGGGCTCTGAAGG - Intronic
1137361427 16:47819792-47819814 AAGAGTAATCAGCGAATTGAAGG - Intergenic
1138574478 16:57898755-57898777 AAGAGTGATCTCGACTCTGAGGG - Intronic
1139866189 16:70064781-70064803 AACAGAGAGAAGGGCTTTGAGGG + Intergenic
1140546961 16:75819965-75819987 AAGAGTGATCAGGGATTGCATGG - Intergenic
1141140929 16:81496451-81496473 AAAAGTGAGAAGGACTTTGAAGG + Intronic
1143559988 17:7687942-7687964 CAGAGTGATAAGGGTTGTGAAGG - Exonic
1145960698 17:28885058-28885080 AAAAGGGATCTGGGCTTTGCAGG + Intronic
1146146509 17:30423061-30423083 AATATTGAACATGGCTTTGAGGG - Intronic
1146709845 17:35031575-35031597 CAGGGTGATCAGTGCTTTAACGG + Intronic
1147493701 17:40895760-40895782 AGGTGTGATCTGGGCTTGGATGG + Intergenic
1148517571 17:48235102-48235124 AAGACTGAGCTGGGTTTTGAAGG + Intronic
1148991986 17:51674004-51674026 AAGCCTGAGCAGGGTTTTGAAGG - Intronic
1149222332 17:54429408-54429430 GAGTGTGATAAGGACTTTGAAGG + Intergenic
1150636822 17:66918905-66918927 AAGACTGAGCAGCGCTTTGGCGG - Intergenic
1152631328 17:81411855-81411877 AAGAGTGACCAGGGTGTGGAGGG - Intronic
1155187000 18:23395784-23395806 CACAGTGATCATGGCTCTGATGG - Intronic
1157315337 18:46582887-46582909 ATGAATGATCAGGGCTTGTATGG + Intronic
1157909111 18:51598382-51598404 AAAATTGAGCTGGGCTTTGAAGG + Intergenic
1158595846 18:58815267-58815289 AAGAGTCATCAGTGCTTCGCAGG - Intergenic
1158815813 18:61095305-61095327 AACAGTGCTCTGGGTTTTGATGG - Intergenic
1160197887 18:76771804-76771826 AAGAGAGTTCAGGGCCTTCAAGG + Intergenic
1160795207 19:942200-942222 AAGAGTGGACAGGGCTCTGCCGG - Intronic
1161622289 19:5304668-5304690 AAAAGAGATCAGGGCTGTAATGG + Intronic
1161644902 19:5447211-5447233 CAGGGTGATTAGGGCTGTGATGG - Intergenic
1163454009 19:17395300-17395322 AGGTGTGATCAGGTCCTTGAAGG - Intergenic
1165309628 19:35022463-35022485 CAGAGTGATCCGGGCTGGGATGG + Intronic
1165396874 19:35569304-35569326 CAGAGTGGTCAGGGCTGTGATGG - Intergenic
1165431730 19:35776775-35776797 CAGAGTGATCAGAGCTGTGAAGG + Intronic
1165447684 19:35865605-35865627 CAGAGTGGTCATGGCTGTGATGG - Intronic
1165767378 19:38359887-38359909 CAGAGTGATCAGGGCTGCAATGG + Intronic
1165792425 19:38500225-38500247 CAGAGTGGTCAGGGCTGGGATGG + Intronic
1165936736 19:39393855-39393877 CAGAGTGGTCAGTGCTGTGATGG + Intronic
1165936753 19:39393926-39393948 CAGAGGGATCAGGGCTGGGATGG + Intronic
1165946991 19:39449528-39449550 CACAGTGGTCAGGGCTGTGATGG + Intronic
1166037790 19:40181760-40181782 AAGAGTGAACAGGGTTTAGCAGG + Intergenic
1166101223 19:40572485-40572507 CAGAGTTATCAGGGCTGTAATGG + Intronic
1166339911 19:42131164-42131186 CAGAGGGATCAGGGCTGGGATGG - Intronic
1166664348 19:44669830-44669852 CAGAGTGATCAGGGCTGGGATGG - Intronic
925296981 2:2783759-2783781 GTGAGTGACCAGGGTTTTGAGGG + Intergenic
928202609 2:29258812-29258834 AAGAGAAATCAGGGCTTTTGAGG - Intronic
929263704 2:39895046-39895068 AAGAATGGGTAGGGCTTTGAGGG - Intergenic
931667276 2:64618335-64618357 AGGAGAGAGCAGGGCCTTGAAGG + Intergenic
932479625 2:72031460-72031482 AAGAAGGATCAGGGCTTGGAGGG - Intergenic
932779543 2:74551392-74551414 AAGAGTCACAAGGACTTTGATGG - Intronic
933266324 2:80184380-80184402 CACAGTGCTTAGGGCTTTGATGG + Intronic
936631006 2:114202630-114202652 AAAAGTGAACAGGGCCTTAAGGG - Intergenic
936654057 2:114463819-114463841 AAAACTGATCAGAGATTTGAAGG - Intronic
936725699 2:115312554-115312576 AAGAGTGTACATGGCCTTGATGG - Intronic
936977619 2:118235301-118235323 AAGAGGGCTCATGGCTTTGCAGG - Intergenic
936982106 2:118274494-118274516 AAGGGTGAAAAGGGCTTTCAAGG - Intergenic
937026138 2:118699415-118699437 AAGAGTGAAGAGGACTTGGATGG - Intergenic
938072308 2:128315182-128315204 AAGAGTGAGCAGAGCATTGGCGG - Intronic
938163589 2:129007893-129007915 ATGAGTGGCCAGGGCATTGAGGG + Intergenic
943215492 2:185028382-185028404 CAGAATGAGCAGGTCTTTGAAGG - Intergenic
943290879 2:186069821-186069843 CAGACTGTTCAGGACTTTGAAGG + Intergenic
944028869 2:195207846-195207868 AAGAGTTGCCAGGGGTTTGAAGG - Intergenic
946044855 2:216812373-216812395 AATAGTGAACAGGGCTTTCTCGG + Intergenic
946497433 2:220208893-220208915 AATTGTGATCAGTGCTTTGAAGG - Intergenic
947743194 2:232494340-232494362 AAGAGAGAGCAGGGCTGTGCAGG + Intergenic
947872095 2:233444881-233444903 CAGAGTGACCAGGGCCATGAAGG - Intronic
948322645 2:237082992-237083014 AAGCGTCTTCAGGGCTGTGATGG - Intergenic
1168758824 20:334639-334661 AAGAGTGAGAAGGACCTTGAAGG + Intergenic
1173419304 20:42886855-42886877 AGAAGTGAACAGGGCTTTGAAGG + Intronic
1173784516 20:45782993-45783015 ATGAGTCATGAGTGCTTTGAAGG - Intronic
1174388825 20:50204644-50204666 AAGACTGCTCAGGGCTCTGCAGG - Intergenic
1174472735 20:50772521-50772543 AACAGTGATGAGCTCTTTGAAGG + Intergenic
1175362251 20:58421793-58421815 CAGAGGGATCAAGGTTTTGAAGG + Intronic
1175865695 20:62175203-62175225 AACAGTGAGCAGGGCTTTGAAGG + Intronic
1176971572 21:15271999-15272021 ACCAGTGGTCAGAGCTTTGAAGG - Intergenic
1177539990 21:22479953-22479975 AAGAAAGATCAGGGTTTTTAAGG + Intergenic
1178811844 21:35891123-35891145 AATATTGCTTAGGGCTTTGAAGG + Intronic
1179058872 21:37961015-37961037 AAGACTGATTAGAGCTTTAAGGG + Intronic
1182768195 22:32774057-32774079 AAGAGTGAGATGGGCTTGGAGGG + Intronic
1183947301 22:41333844-41333866 AACTGTGATGAGGGCTGTGAAGG + Intronic
1184179796 22:42812964-42812986 AAGAGAGATCAGGACACTGAAGG + Intronic
1184419992 22:44374206-44374228 GAGAGTGATCAGGGCTGTAATGG + Intergenic
1184483049 22:44759311-44759333 CAGACTGATGAGGGCTGTGATGG + Intronic
952238987 3:31510261-31510283 AAGAATGATCACACCTTTGATGG - Intergenic
952658199 3:35813169-35813191 AAGAGTAATCAGGGCCCTGATGG - Intergenic
953467964 3:43140969-43140991 AAAAGTGATCAGGGATTTCCAGG + Intergenic
953524572 3:43678115-43678137 AAGAGTGCTCAGGACATTTAAGG - Intronic
954553818 3:51503192-51503214 AAGAGTGAGGAGTGCTTTGGGGG + Intergenic
955467947 3:59255844-59255866 AAATGTGGTTAGGGCTTTGAAGG + Intergenic
955488649 3:59460582-59460604 AAGAGTGATATGGACTCTGAGGG + Intergenic
956454613 3:69408525-69408547 AAGAGAGAGCAGGACTGTGATGG + Intronic
956695910 3:71919288-71919310 AAGTGTCATCAGAGCTTTCACGG - Intergenic
959005996 3:101020561-101020583 AAGAGAGTTCAGGGCTTGGCAGG + Intergenic
959274979 3:104267220-104267242 AAGAGTCTTCAGGGTTTTCAAGG + Intergenic
959438598 3:106348831-106348853 ATGTATGATAAGGGCTTTGATGG + Intergenic
960189549 3:114686734-114686756 AAGAGTGATGAAGGCCTTCAGGG - Intronic
960534563 3:118802313-118802335 CAGAGTAATCAGGGCTGGGAGGG + Intergenic
964679964 3:159327687-159327709 CAGAGTTATTAGGGCCTTGAGGG - Intronic
964872278 3:161326154-161326176 AGCAGTGATGAGGGCTTTGAAGG + Intergenic
966202507 3:177372022-177372044 AGAATTGATCTGGGCTTTGAAGG - Intergenic
967399480 3:189044567-189044589 AAAAGTGAGCTGAGCTTTGAAGG + Intronic
967625731 3:191681625-191681647 GAGAGTGAGCAAGGCATTGAAGG - Intergenic
968862592 4:3184581-3184603 GAGAGAGAGCAGGGCTTTGGGGG + Intronic
969185679 4:5472466-5472488 AGGGCTGGTCAGGGCTTTGAAGG + Intronic
972356072 4:38280479-38280501 AAGCCTGAGCAGGGTTTTGAGGG - Intergenic
972938736 4:44171120-44171142 AAGAGTGTTCAAGGCCCTGAAGG - Intergenic
975086842 4:70352037-70352059 TGGGGTGATGAGGGCTTTGATGG - Intergenic
978721190 4:111911613-111911635 GAGAGTGATTAGGTCTTGGAAGG + Intergenic
979585178 4:122406909-122406931 AAGTGTGATAAGTGCTTTGAAGG - Intronic
981045560 4:140261858-140261880 ATGTGTGACCAGGGCTTGGAAGG + Intronic
981051133 4:140310654-140310676 AAAAGTGAACAGGGCTGAGAGGG - Intronic
981985827 4:150854566-150854588 AATAGTAATAAGAGCTTTGAAGG + Intronic
984377502 4:178951805-178951827 AAAAGTCATCTGGGATTTGAGGG - Intergenic
986790788 5:11157638-11157660 AATAGTGATCTTGGCTTTGTTGG + Intronic
988600741 5:32637633-32637655 AAAAGTAATCAGGGCTCTGGTGG - Intergenic
989456064 5:41645865-41645887 AATAGTCATCAGGCTTTTGAAGG - Intergenic
989584232 5:43062289-43062311 CATAGAGATGAGGGCTTTGAGGG + Intergenic
990538773 5:56751288-56751310 AACAATGATCAGGCATTTGAAGG - Intergenic
996977501 5:129452434-129452456 AAGAGGGAAAAGGGCTATGAGGG - Intergenic
997602904 5:135152501-135152523 CAGAGGGATCATGGCTGTGATGG - Intronic
997894225 5:137701710-137701732 AAGAGTGACCAAGTCCTTGATGG - Intronic
998391121 5:141787632-141787654 CAAAGTGATCAGGGCTAGGATGG + Intergenic
998624397 5:143829111-143829133 AAGAGTAAACAAGGCTTGGAGGG - Intergenic
999595726 5:153202064-153202086 AAGAGTGATAAGGGGGTGGATGG - Intergenic
999826788 5:155281263-155281285 AAGAGAGATGATGCCTTTGAGGG + Intergenic
1000116358 5:158157479-158157501 AAGAGTGGTAAAGGCTTTGTTGG - Intergenic
1001065522 5:168532346-168532368 AAAAGTGATCCTGGCTTTGCAGG - Intergenic
1001071090 5:168585740-168585762 AAGCTTCATCTGGGCTTTGAAGG - Intergenic
1002804311 6:557746-557768 AAGAGGGACCAGCCCTTTGAAGG + Intronic
1003715614 6:8642957-8642979 TAGTGTGATGAGGGCTTTGAAGG + Intergenic
1004271415 6:14199473-14199495 AAGAGAGTTCACTGCTTTGAGGG + Intergenic
1005003108 6:21262694-21262716 ATGTGTGAGCAGGGTTTTGAAGG - Intergenic
1005583509 6:27254501-27254523 CACAGTGATCAGGGCTGTGATGG - Intronic
1005593946 6:27359778-27359800 AAGAGTGATGTGGCCTCTGAAGG + Intergenic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1007074575 6:39058324-39058346 AGAAGTGATCAGGGCATTGGTGG + Intronic
1008186171 6:48393795-48393817 AATAGTTGCCAGGGCTTTGAAGG + Intergenic
1009625225 6:66130908-66130930 AGGAGTGTTCAGGGCTGTGTTGG - Intergenic
1012785724 6:103623180-103623202 AAAGGAGATCTGGGCTTTGAAGG + Intergenic
1013173046 6:107654760-107654782 AGGAGGAATCAGGGCTCTGAGGG + Intronic
1013173057 6:107654803-107654825 AGGAGGAATCAGGGCTCTGAGGG + Intronic
1013173085 6:107654931-107654953 AAGAGGAATCAAGGCTCTGAGGG + Intronic
1015365908 6:132397867-132397889 AAGAGTGATGAGAGCTTGAATGG - Intronic
1015434105 6:133166029-133166051 AAAAGTGAGCAGAGATTTGAAGG + Intergenic
1018068374 6:160139760-160139782 AATGGTGATGAGGGCTATGAAGG - Exonic
1019928945 7:4210845-4210867 GAGCGTGATCAGTGCTTTGGAGG + Intronic
1021007159 7:15412482-15412504 AAGAGTCAGCCAGGCTTTGAGGG - Intronic
1022732189 7:33038462-33038484 AAGAGTGATAAGAAATTTGATGG + Intronic
1024048611 7:45602038-45602060 AAGAGTGATCAGGGCTTTGAGGG + Intronic
1024315257 7:48010041-48010063 AAGAGAGTGCAGGGCTTTGGAGG - Intronic
1024707047 7:51972262-51972284 AAGGGTGATCAGAACTTTGAGGG + Intergenic
1024799990 7:53065797-53065819 AAGATTGCTCAGGGGATTGAAGG + Intergenic
1026697795 7:72611230-72611252 AAGTGTAATCAGAGCTATGATGG - Intronic
1027427270 7:78074049-78074071 GAAAATGATAAGGGCTTTGAAGG - Intronic
1029542892 7:101194926-101194948 AAGAGTGAGCAGGATTTAGATGG - Intergenic
1029977138 7:104845432-104845454 AAGTGTGAGCATGGCTTTGTGGG + Intronic
1030061636 7:105626335-105626357 AAGAGTTATCAGGAGTTGGAAGG + Intronic
1034359042 7:150477867-150477889 AAGCGGGTTCATGGCTTTGAGGG + Exonic
1035065771 7:156104219-156104241 AAGCTTGGCCAGGGCTTTGAGGG + Intergenic
1035112171 7:156492284-156492306 GACAGTGAGCAGGGCTGTGAAGG - Intergenic
1036610217 8:10343356-10343378 AGGAGTGATCAGTGTTTTCAGGG + Intronic
1038363224 8:26904296-26904318 AAAAGTGAGCAGGAATTTGAAGG + Intergenic
1038897342 8:31799818-31799840 AAGAAGGATCAGAGCTGTGACGG - Intronic
1040959314 8:53014398-53014420 GAGAGGGATCAGGGCTGGGAAGG - Intergenic
1041269687 8:56099386-56099408 AAGAGTGATGAGTGTTATGAAGG + Intergenic
1041880637 8:62745815-62745837 AGGAATGATCAGGGCTTTGGAGG + Intronic
1042090337 8:65152476-65152498 AAGAGTGATCAAAGCCTGGAGGG + Intergenic
1045438919 8:102190842-102190864 AAGAGTGAATAAGGCTTGGAAGG - Intergenic
1047313041 8:123708394-123708416 AACAGTGATCGGGGCTGTGGTGG + Intronic
1047368374 8:124233635-124233657 AACAGTGATAAGTGCTATGAAGG - Intergenic
1048776833 8:137955814-137955836 AAGAGGGATGAGAGTTTTGAAGG + Intergenic
1050307305 9:4318215-4318237 AAGAGTTATCTGGTGTTTGATGG + Intronic
1051556121 9:18384493-18384515 GAGAGAGATGAGGGCATTGAAGG - Intergenic
1052023819 9:23553623-23553645 AAGAGTGAGTAGTGATTTGAAGG + Intergenic
1054460333 9:65458932-65458954 CAGAGTGAGAAGGGCTATGAGGG - Intergenic
1056962742 9:91141141-91141163 AAAGGTGTTTAGGGCTTTGAGGG + Intergenic
1057092442 9:92271043-92271065 AAGTATCATCAGGACTTTGAAGG - Exonic
1059310731 9:113387453-113387475 AATTGTGATAAGTGCTTTGAAGG - Exonic
1059989172 9:119848488-119848510 CAGACTGAGCAGGGCTTTGGAGG - Intergenic
1060667380 9:125439933-125439955 AAGAGTGAGCGGGCTTTTGAGGG + Intronic
1060673878 9:125494850-125494872 AATTGTGATCAGTGCTGTGAAGG - Intronic
1187520679 X:20011273-20011295 CAGATTGAGCAGGGCTGTGATGG + Intronic
1188572887 X:31610812-31610834 ACTAGTGATCATGGCTCTGATGG + Intronic
1189383575 X:40518919-40518941 AAGCGTGGCCAGGGCTTTCAGGG - Intergenic
1190166031 X:48073492-48073514 GAGAGAATTCAGGGCTTTGAGGG - Intergenic
1190652854 X:52583410-52583432 AAGGGGGATCAGGGCTGGGACGG + Intergenic
1190742701 X:53300449-53300471 CAGTTTGATCAGGGCTGTGATGG - Intronic
1193710770 X:84877108-84877130 AAAAGTGATCAGTGATTTGCTGG - Intergenic
1198603609 X:138312170-138312192 GACTGTGATGAGGGCTTTGATGG + Intergenic
1198875162 X:141216851-141216873 AAGGGTGATCAGAGTGTTGATGG - Intergenic
1200043775 X:153388727-153388749 CAGAGTGTACTGGGCTTTGAGGG + Intergenic
1202102438 Y:21324384-21324406 AAGAATGATGAGAGGTTTGAGGG + Intergenic