ID: 1024050369

View in Genome Browser
Species Human (GRCh38)
Location 7:45617364-45617386
Sequence CTAGCCTGCAACTCGGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 79}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024050369_1024050375 2 Left 1024050369 7:45617364-45617386 CCTGGGGCCGAGTTGCAGGCTAG 0: 1
1: 0
2: 1
3: 11
4: 79
Right 1024050375 7:45617389-45617411 ATGGACTGCCTAGGTCTGAAGGG 0: 1
1: 0
2: 0
3: 5
4: 92
1024050369_1024050381 26 Left 1024050369 7:45617364-45617386 CCTGGGGCCGAGTTGCAGGCTAG 0: 1
1: 0
2: 1
3: 11
4: 79
Right 1024050381 7:45617413-45617435 CAGCTGTGATAGGTGGGACTGGG No data
1024050369_1024050378 19 Left 1024050369 7:45617364-45617386 CCTGGGGCCGAGTTGCAGGCTAG 0: 1
1: 0
2: 1
3: 11
4: 79
Right 1024050378 7:45617406-45617428 GAAGGGTCAGCTGTGATAGGTGG No data
1024050369_1024050374 1 Left 1024050369 7:45617364-45617386 CCTGGGGCCGAGTTGCAGGCTAG 0: 1
1: 0
2: 1
3: 11
4: 79
Right 1024050374 7:45617388-45617410 CATGGACTGCCTAGGTCTGAAGG No data
1024050369_1024050379 20 Left 1024050369 7:45617364-45617386 CCTGGGGCCGAGTTGCAGGCTAG 0: 1
1: 0
2: 1
3: 11
4: 79
Right 1024050379 7:45617407-45617429 AAGGGTCAGCTGTGATAGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 110
1024050369_1024050377 16 Left 1024050369 7:45617364-45617386 CCTGGGGCCGAGTTGCAGGCTAG 0: 1
1: 0
2: 1
3: 11
4: 79
Right 1024050377 7:45617403-45617425 TCTGAAGGGTCAGCTGTGATAGG No data
1024050369_1024050373 -7 Left 1024050369 7:45617364-45617386 CCTGGGGCCGAGTTGCAGGCTAG 0: 1
1: 0
2: 1
3: 11
4: 79
Right 1024050373 7:45617380-45617402 AGGCTAGGCATGGACTGCCTAGG No data
1024050369_1024050380 25 Left 1024050369 7:45617364-45617386 CCTGGGGCCGAGTTGCAGGCTAG 0: 1
1: 0
2: 1
3: 11
4: 79
Right 1024050380 7:45617412-45617434 TCAGCTGTGATAGGTGGGACTGG 0: 1
1: 0
2: 1
3: 18
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024050369 Original CRISPR CTAGCCTGCAACTCGGCCCC AGG (reversed) Intronic
903438087 1:23367824-23367846 CTGGCCTGGTACTAGGCCCCTGG + Intronic
903474949 1:23613225-23613247 AAAGCCTGCAGCTGGGCCCCAGG + Intronic
905461614 1:38126217-38126239 TTTGCCTGCATCTCCGCCCCAGG + Intergenic
913328267 1:117646570-117646592 CTAGTCTGCCACTGGGCCTCTGG - Intergenic
918215555 1:182390341-182390363 CTGGCATGCAACTCGGCTCACGG - Intronic
922167529 1:223128426-223128448 CTAACCTGCCACTGGGACCCAGG - Intronic
1073480595 10:103784031-103784053 GTAGCCTGCAGCTGGGCACCAGG - Intronic
1075654410 10:124151932-124151954 CTACCCTGCACCACTGCCCCGGG + Intergenic
1077310666 11:1887656-1887678 GTAGCCTGCAACAGGGCTCCAGG - Intronic
1077349664 11:2086604-2086626 CTCGCCTGCCACCCCGCCCCTGG - Intergenic
1081507808 11:43736227-43736249 CTTGCCTGGAAGTCGGCCCAGGG + Intronic
1083505787 11:63156409-63156431 CTGGCCTGCAACTCCCCCACTGG + Intronic
1084709534 11:70835507-70835529 TTGGCCTGCACCTCGGCCCCTGG - Intronic
1092155797 12:6280821-6280843 CTGGCCTCCTGCTCGGCCCCTGG + Intergenic
1092262101 12:6958345-6958367 CTGGCCAGCAACTGGGTCCCGGG - Intronic
1095963621 12:47851647-47851669 CTAGGCTCCAACTGGGCCCAGGG - Intronic
1096073488 12:48788643-48788665 CCAGCCTGGAACTCGCCCCGTGG + Intronic
1104695361 12:130859419-130859441 CTAGCCTTCAACTCGTGCCCTGG + Intergenic
1105477658 13:20742386-20742408 CTAGCTTGCAACTAGGACCTAGG + Intronic
1109314358 13:60732827-60732849 CTAGCCTGCAGCTAGGGGCCAGG + Intergenic
1112362532 13:98730515-98730537 CCAGCATGAAACTCGGCCGCAGG - Intronic
1112747376 13:102541805-102541827 CTAGACTGCAACTCTGTCTCTGG + Intergenic
1113670549 13:112172747-112172769 CTACCCTGCAACTTGAGCCCAGG - Intergenic
1117314174 14:54557706-54557728 CTAGCCGGCTACAGGGCCCCCGG - Intergenic
1119323188 14:73743537-73743559 CCAGCCTGCAACTCGGGGTCAGG + Intronic
1119660840 14:76450604-76450626 CAAGCCTGCATCTGGGCCCCAGG - Intronic
1126516123 15:49539854-49539876 CTAGCCTGCACCTGGGACCATGG - Intronic
1129887343 15:79047907-79047929 CTAGCCAGCAGGTCTGCCCCTGG - Intronic
1130664127 15:85854891-85854913 CCAGCCTGCAGCCCAGCCCCAGG - Intergenic
1132568744 16:635012-635034 CCAGCCTGCAAGTCTGTCCCAGG - Intronic
1132684167 16:1155341-1155363 CGGGCCTGCACCTCGGCTCCCGG - Intronic
1138031510 16:53562987-53563009 ATGGCCTGTAACACGGCCCCAGG + Intergenic
1139058704 16:63221605-63221627 ATAGCCTGTGACTTGGCCCCAGG - Intergenic
1142625028 17:1186544-1186566 CGGGGCTTCAACTCGGCCCCTGG - Intronic
1146491691 17:33287960-33287982 GTAGCCTGCAACAAGGCTCCTGG - Intronic
1147547497 17:41413942-41413964 CTAGCCTCCAGCTCAGCCCCTGG - Intergenic
1152461262 17:80443697-80443719 CGACCCTGCCACTCGGCCTCGGG - Intergenic
1152710740 17:81869565-81869587 CTGGTGTGCAGCTCGGCCCCGGG - Exonic
1159941386 18:74411657-74411679 CAAAACTGAAACTCGGCCCCGGG + Intergenic
1160707717 19:537189-537211 CCGGCCTGCACCCCGGCCCCTGG + Intronic
1161948724 19:7455198-7455220 CTACCATCCAACTCGGCGCCTGG - Intronic
1163292777 19:16391531-16391553 CTAGGCTGCAACCCAGGCCCGGG - Intronic
1164404299 19:27929126-27929148 CAAGCCTGCAAATCAGCCACTGG - Intergenic
1165326246 19:35116087-35116109 ATGGGCTGGAACTCGGCCCCTGG - Intronic
925008465 2:464687-464709 CTGGCCAGCACCTCAGCCCCTGG + Intergenic
929581980 2:43087057-43087079 CCATCCTGGAACTCAGCCCCAGG + Intergenic
931565576 2:63612832-63612854 CTAGCCTCCATCTCGGGCCCTGG - Intronic
932558169 2:72843617-72843639 CTAGCCTGCTCCTCTTCCCCAGG + Intergenic
933148721 2:78889185-78889207 CTTGCCTGCTACTTGGCCCTGGG - Intergenic
935072147 2:99704475-99704497 CTAGCCTGCACCTTGCCACCTGG - Intronic
938104287 2:128519713-128519735 CTAGCCTGCTCCTGGGCCCCAGG + Intergenic
938337671 2:130513674-130513696 CTACCCTGCAACTTAGCCACAGG + Intergenic
938352168 2:130607061-130607083 CTACCCTGCAACTTAGCCACAGG - Intergenic
941308283 2:163897837-163897859 CTAGCCTGTAACTCAGCTCTGGG - Intergenic
942755515 2:179337034-179337056 TTAGCCTGCAGCTGAGCCCCAGG + Intergenic
947768388 2:232651962-232651984 CTAACCCGCAGCTCTGCCCCAGG - Intronic
948903792 2:240968421-240968443 CCAGCCTGCACCTCTGCCCCAGG - Intronic
948991178 2:241554890-241554912 CTAGCATGGAACTCGGTCCCTGG - Intergenic
1176013595 20:62915016-62915038 CTAGCTAGAAACTCGGCACCTGG - Intronic
1176120541 20:63452728-63452750 CTCGCCGGCAGCTCGGCTCCAGG + Intronic
1180636671 22:17267337-17267359 CTAGACTGTAGCTCTGCCCCAGG + Intergenic
952232689 3:31448163-31448185 CTAGCCTGGAACTCAGCGCTGGG - Intergenic
953875527 3:46664521-46664543 ATAGCCTGCACCACTGCCCCTGG - Intergenic
954114653 3:48459664-48459686 CTAGGCTGCCACTAAGCCCCAGG - Intronic
970427992 4:15963147-15963169 CTTGCTTGCAACTCTGCACCAGG + Exonic
979171930 4:117610966-117610988 CTAGCATGCAACTCAGGCCCTGG + Intergenic
985129254 4:186724539-186724561 CTAGCCCGGGAGTCGGCCCCAGG + Intronic
985514761 5:335799-335821 CTGGCCCGCAACTCAGCTCCAGG + Intronic
985965832 5:3338326-3338348 CCAGCCTGGAACTGAGCCCCAGG + Intergenic
992732947 5:79690467-79690489 CTAGCCTACTGCTAGGCCCCCGG - Intronic
995099241 5:108278580-108278602 CTGGCCTGCAACTCAGTCCTGGG - Intronic
997421006 5:133766717-133766739 CTAACCTGGAACTCGGCACTTGG - Intergenic
1002429295 5:179193858-179193880 CTTGACTGCAACTCAGCTCCAGG + Intronic
1019625342 7:2013080-2013102 CTACCCAGCAGCTCGGCTCCAGG + Intronic
1022293022 7:29022196-29022218 CTAGCCTGCCTCTTGGCCCAAGG + Intronic
1024050369 7:45617364-45617386 CTAGCCTGCAACTCGGCCCCAGG - Intronic
1024064343 7:45720073-45720095 CTGGCCTCCAAATCGGCTCCTGG - Exonic
1029693282 7:102196659-102196681 CCAGCCTGAAAGTCGGCGCCCGG + Exonic
1033656681 7:143380290-143380312 TCAGCCTGCGACTCAGCCCCAGG - Intergenic
1034677589 7:152902895-152902917 CTAGGCTGAATCTGGGCCCCCGG + Intergenic
1036220928 8:6921185-6921207 CTGGCCTGCAGCTCCTCCCCGGG - Intergenic
1048859883 8:138716334-138716356 ATGGCCTGCAGCTTGGCCCCTGG - Intronic
1049541358 8:143210605-143210627 CGAGCCTGCACCTGCGCCCCTGG - Intergenic
1049645928 8:143735586-143735608 CTTGCCTGCCCCTCCGCCCCAGG - Intergenic
1052290422 9:26833966-26833988 ATAGCCTGCAGCTGTGCCCCGGG + Intergenic
1053114601 9:35490083-35490105 CTAGCCTGCAACGCGACCCCTGG + Intergenic
1056196176 9:84230956-84230978 CTAGCCAGCAGATCAGCCCCTGG + Intergenic
1060403791 9:123362915-123362937 GTAGCCTGGCACTCGGTCCCTGG - Exonic
1062062291 9:134502945-134502967 CAAGCCTGCCCCTGGGCCCCAGG - Intergenic
1062303403 9:135888465-135888487 GTAGCCTCCAACTCAGCCCCAGG + Intronic
1195403943 X:104492442-104492464 CTAGCCTTCACCTTTGCCCCTGG + Intergenic
1199571953 X:149275019-149275041 CTAGCCTGCAACTTGGCACAAGG + Intergenic