ID: 1024050372

View in Genome Browser
Species Human (GRCh38)
Location 7:45617371-45617393
Sequence TCCATGCCTAGCCTGCAACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 137}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024050372_1024050381 19 Left 1024050372 7:45617371-45617393 CCGAGTTGCAGGCTAGGCATGGA 0: 1
1: 0
2: 3
3: 17
4: 137
Right 1024050381 7:45617413-45617435 CAGCTGTGATAGGTGGGACTGGG No data
1024050372_1024050379 13 Left 1024050372 7:45617371-45617393 CCGAGTTGCAGGCTAGGCATGGA 0: 1
1: 0
2: 3
3: 17
4: 137
Right 1024050379 7:45617407-45617429 AAGGGTCAGCTGTGATAGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 110
1024050372_1024050378 12 Left 1024050372 7:45617371-45617393 CCGAGTTGCAGGCTAGGCATGGA 0: 1
1: 0
2: 3
3: 17
4: 137
Right 1024050378 7:45617406-45617428 GAAGGGTCAGCTGTGATAGGTGG No data
1024050372_1024050382 29 Left 1024050372 7:45617371-45617393 CCGAGTTGCAGGCTAGGCATGGA 0: 1
1: 0
2: 3
3: 17
4: 137
Right 1024050382 7:45617423-45617445 AGGTGGGACTGGGATGAGAGAGG No data
1024050372_1024050375 -5 Left 1024050372 7:45617371-45617393 CCGAGTTGCAGGCTAGGCATGGA 0: 1
1: 0
2: 3
3: 17
4: 137
Right 1024050375 7:45617389-45617411 ATGGACTGCCTAGGTCTGAAGGG 0: 1
1: 0
2: 0
3: 5
4: 92
1024050372_1024050380 18 Left 1024050372 7:45617371-45617393 CCGAGTTGCAGGCTAGGCATGGA 0: 1
1: 0
2: 3
3: 17
4: 137
Right 1024050380 7:45617412-45617434 TCAGCTGTGATAGGTGGGACTGG 0: 1
1: 0
2: 1
3: 18
4: 183
1024050372_1024050383 30 Left 1024050372 7:45617371-45617393 CCGAGTTGCAGGCTAGGCATGGA 0: 1
1: 0
2: 3
3: 17
4: 137
Right 1024050383 7:45617424-45617446 GGTGGGACTGGGATGAGAGAGGG No data
1024050372_1024050374 -6 Left 1024050372 7:45617371-45617393 CCGAGTTGCAGGCTAGGCATGGA 0: 1
1: 0
2: 3
3: 17
4: 137
Right 1024050374 7:45617388-45617410 CATGGACTGCCTAGGTCTGAAGG No data
1024050372_1024050377 9 Left 1024050372 7:45617371-45617393 CCGAGTTGCAGGCTAGGCATGGA 0: 1
1: 0
2: 3
3: 17
4: 137
Right 1024050377 7:45617403-45617425 TCTGAAGGGTCAGCTGTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024050372 Original CRISPR TCCATGCCTAGCCTGCAACT CGG (reversed) Intronic
900172721 1:1277409-1277431 CCCATGCCTGGCCTTCAGCTGGG + Intergenic
901392133 1:8953332-8953354 ACCATGCCTGGCCTGCATATGGG - Intronic
902087879 1:13877139-13877161 TCCATGCCCAGCCCCCTACTAGG + Intergenic
903052785 1:20613965-20613987 TGCCTGCCATGCCTGCAACTTGG - Intronic
903958643 1:27042293-27042315 CCCATGCCCGGCCTGCAACAGGG - Intergenic
905729202 1:40284239-40284261 ACCATGCCTGGCCTTCAGCTTGG + Intronic
908498182 1:64716182-64716204 GCCATGCCTAGCCTGCAAGTAGG + Intergenic
909299560 1:73994883-73994905 TGGATGTCTAGCCTGCAATTTGG - Intergenic
917237736 1:172912870-172912892 TCCATGCTCAGCCTGCAGCTGGG + Intergenic
920188816 1:204179372-204179394 TCCATCCCCAGCCTGGGACTCGG - Intergenic
920560113 1:206932757-206932779 TCCAGGCCTAGGATGCAACAAGG - Intronic
1063627355 10:7702463-7702485 CCCATGCCTAGCCTCCATCCTGG - Intergenic
1066508210 10:36066728-36066750 TCCATCCCTGGCTTGAAACTGGG - Intergenic
1067287133 10:44914826-44914848 TGCTTTCCTAGCCTGCAACTGGG - Intronic
1068657856 10:59593217-59593239 TCCCTGCCCAGCTTGCAACTAGG - Intergenic
1069749002 10:70733874-70733896 TCCATGCCGAGCCTGGAATGGGG - Exonic
1074047863 10:109855213-109855235 ACCATGCCCAGCCTGGATCTTGG + Intergenic
1074215649 10:111381413-111381435 TCCATGTTCAGCCTGCAGCTGGG + Intergenic
1075560428 10:123464304-123464326 TCCATCCACAGCCTTCAACTTGG + Intergenic
1078009508 11:7561353-7561375 ACCATGCCTGGCCTACAAGTAGG + Intronic
1081403228 11:42666683-42666705 ACCATGCCTGGCCTCCCACTGGG - Intergenic
1082968798 11:58996990-58997012 TCCATGCCTAACCTGATCCTGGG + Intronic
1083325769 11:61872245-61872267 TCCCTGCCCAGCCTGTGACTAGG - Intergenic
1083798470 11:65032355-65032377 CCCATGCCTAGCCTGCCCCCAGG - Intronic
1085047044 11:73359738-73359760 TCACTGCATAGCCTGCAGCTGGG - Intronic
1085418166 11:76333633-76333655 TCCTTGTGTAGCCTGGAACTTGG + Intergenic
1086720995 11:90120661-90120683 ACCATGCCTGGCCTGCTACAAGG - Intergenic
1086818622 11:91406237-91406259 TCCATGCTCAGCCTGCAGCTGGG + Intergenic
1089280071 11:117367980-117368002 TCCCTTCCTAGCCTGCAAAAAGG - Intronic
1090249877 11:125243909-125243931 ACCATGCCCAGCCTGTACCTGGG + Intronic
1091301412 11:134510402-134510424 GCCCTGCCCAGCCAGCAACTGGG + Intergenic
1096268411 12:50143454-50143476 ACCATGCCTGGCCTGCAATTTGG - Intronic
1097333384 12:58356126-58356148 ACCATGCCTGGCCTGGCACTTGG + Intergenic
1097357939 12:58622924-58622946 TACCTGCCTTGCCTGCCACTTGG - Intronic
1101044875 12:100794694-100794716 ACCATGCCTCCCCTGCACCTGGG + Intronic
1101420714 12:104548670-104548692 TTCTTGCCTCTCCTGCAACTAGG - Intronic
1101433068 12:104643032-104643054 ACCATGCCCAGCCTACAACACGG - Intronic
1102652686 12:114453569-114453591 TCCATGCATTTCCTGAAACTTGG - Intergenic
1102752619 12:115308869-115308891 TCCAGACCTAGCCAGCAAGTTGG + Intergenic
1106367193 13:29092610-29092632 CCCATGCTCAGCCTACAACTGGG - Intronic
1106598696 13:31169161-31169183 ACCATGCCTAGACTGCCCCTTGG - Intergenic
1108575355 13:51785654-51785676 TCCATACCAAACCTGCAGCTTGG + Intronic
1108700743 13:52941825-52941847 TCCATGCCTGGCCCTCAGCTTGG - Intergenic
1114618330 14:24080370-24080392 CCCCTGCCTAGGCTGCAGCTGGG + Exonic
1117012646 14:51486321-51486343 ACCATGCCCGGCCTGCAAGTTGG + Intergenic
1117546627 14:56798500-56798522 TCCATCCCTGGCCCGCACCTAGG - Intergenic
1117554824 14:56873122-56873144 ACCATGCCCAGCCTGGAACATGG + Intergenic
1118036887 14:61877615-61877637 TCTATGCCCAGCCTGGATCTGGG - Intergenic
1118988208 14:70775259-70775281 TTCATGGCTATCCTGCAAGTTGG + Intronic
1121501601 14:94442599-94442621 ACCATGGTTACCCTGCAACTGGG + Exonic
1122347082 14:101067377-101067399 TCCATGCCTAGCATGGGAGTGGG + Intergenic
1122638645 14:103143390-103143412 CCCATGCGTAGCCTCCATCTTGG + Intergenic
1123826357 15:24086259-24086281 TCCATGCTTAGCCTGCAGCTGGG + Intergenic
1128157711 15:65402250-65402272 TCCAGGCCTTGCCTTCAAGTAGG - Intronic
1129280006 15:74477186-74477208 TCCCTGCCTCCCTTGCAACTGGG + Intergenic
1129292894 15:74582078-74582100 TCCCTGCTTTGCCTGCCACTGGG - Intronic
1129390327 15:75217077-75217099 TCCAGTCCTGGCCTGGAACTCGG + Intergenic
1133270501 16:4608944-4608966 TGCATGCCTCCCCTGCACCTGGG - Exonic
1133394267 16:5433449-5433471 TCCAACCCTAGCCTGAAAATAGG + Intergenic
1140502642 16:75448041-75448063 CCCATGCCTAGCCTTCAACAGGG + Intronic
1144451999 17:15388876-15388898 CCCAAGCCTTGCCTGCAGCTCGG + Intergenic
1144793888 17:17878138-17878160 TCCATTCCTAGCCTGCAGGAAGG - Intronic
1144815543 17:18031960-18031982 CCCATGTCTAGCCTGCCATTTGG - Intronic
1145897554 17:28469251-28469273 TCCCTGCCCAGCCTCCAACAGGG + Intronic
1147118820 17:38323002-38323024 TCCATGCCCAGCCTGAACCAGGG - Exonic
1149230936 17:54533103-54533125 ACCATGCCCAGCCTGCCTCTAGG + Intergenic
1152415070 17:80154446-80154468 TCCAGGCCTTGCCTGGATCTAGG - Intergenic
1152738885 17:82010627-82010649 TCCATGCCCAGCCTGCCACGGGG + Intronic
1153219987 18:2853103-2853125 TAAATGCCTAGCATGCAGCTAGG - Intronic
1153932988 18:9895389-9895411 CCCAAGCCTAGCTTGGAACTTGG - Intergenic
1157746383 18:50139527-50139549 TCCATGACCAGCCTGTGACTTGG - Intronic
1159772305 18:72560236-72560258 TCCATGACTGGCCTGCATCTGGG - Intronic
1162752075 19:12835037-12835059 TCCATCCCCAGCCTGAATCTTGG + Intronic
1163522484 19:17799730-17799752 TCTCTGCCTTGCCTGCAGCTGGG - Intronic
1167101931 19:47409061-47409083 TCCATTCCCACCCTGCACCTGGG + Intronic
925763265 2:7207142-7207164 TCCATGCCCGGCCTGTAACGGGG + Intergenic
927490277 2:23516760-23516782 TCCATGCCTGCCCTGGCACTGGG + Intronic
928374374 2:30763091-30763113 TCCATGCCTACACTGTGACTGGG - Exonic
928789093 2:34929714-34929736 TCCATGCATTTCCTGAAACTTGG + Intergenic
928918256 2:36497965-36497987 TCTATTCCCAGCCTGCTACTGGG + Intronic
929086429 2:38172049-38172071 TCCATGCATAGACTGAAACTTGG - Intergenic
929931923 2:46263862-46263884 TCCATGCCTCACCTGCCACCTGG + Intergenic
931677188 2:64709160-64709182 TCCATGCCTCTCCTGAAACCTGG + Intronic
932205407 2:69876697-69876719 ACCACGCCAAGCCTGCAATTTGG - Intronic
933245131 2:79966523-79966545 TCTGTGCCTGGCCTGTAACTGGG + Intronic
937005892 2:118513485-118513507 ACCATGCCTGGCCCGAAACTGGG + Intergenic
938043628 2:128097085-128097107 ACCATGCCTGGCCTGCTACAAGG - Intronic
1170254141 20:14320695-14320717 TACATGCCTAGCCTTCATCTGGG + Intronic
1171034152 20:21703087-21703109 ACCAAGCCTAGCCTGCAGCTCGG + Intergenic
1171360798 20:24585124-24585146 TCCCAGCCTATCCTCCAACTGGG - Intronic
1173333547 20:42095429-42095451 TGCATGCCTACCCTGCAGCCTGG + Intronic
1173518782 20:43683841-43683863 ACCGTGCCTGGCCTGGAACTAGG + Intronic
1174550258 20:51356957-51356979 ATCATGCCCGGCCTGCAACTGGG + Intergenic
1175757481 20:61538820-61538842 CCCATGCCTGGCCTGCAGCAGGG - Intronic
1177677830 21:24325011-24325033 TCCATGCCTAGCCTCTATCTTGG + Intergenic
1178532522 21:33387359-33387381 ACCATGCCCAGCCTGATACTTGG + Intergenic
1178924126 21:36761065-36761087 GCCATGCCCGGCCTGCAACGTGG - Intronic
1181952911 22:26567355-26567377 TCAAGGCCTAGCCTGGAAGTTGG + Intronic
1182318416 22:29463034-29463056 ACCATGTCTGGCCTGGAACTGGG - Intergenic
1182793315 22:32971578-32971600 TCCATGCCTGGGCTGTAACCAGG + Intronic
1183340665 22:37279149-37279171 TCCATGCCCAGGCTGCTACAGGG + Intergenic
952532572 3:34277330-34277352 TCCAGGCATACCCTGCAGCTAGG - Intergenic
952827747 3:37538175-37538197 TCCATGGTTAGCCTGAAACTCGG + Intronic
952951406 3:38528381-38528403 TCCATGCCTAGCCTCCATCTGGG + Intronic
953822911 3:46223795-46223817 CCCATGGCTTGCCTGAAACTTGG + Intronic
953925643 3:46981059-46981081 TCCATGCCTGGCCTCCTGCTGGG - Intronic
958758215 3:98275244-98275266 TCCGTGCTTAGCCTGCAGCTGGG - Intergenic
959468553 3:106720741-106720763 TCCGTGCTCAGCCTGCAGCTGGG + Intergenic
961175420 3:124831243-124831265 ACCATGCCTGGCCTGCCTCTGGG - Intronic
961750160 3:129089795-129089817 GCCATGCCTGGCCTGCCCCTGGG + Exonic
962311138 3:134327603-134327625 TCCATGCCAAGCCTGGCAGTGGG + Intergenic
963613127 3:147497548-147497570 TTCAGGCCTTCCCTGCAACTGGG - Intronic
964733642 3:159893820-159893842 TCCTTGCCTAGCCTGCCTCTTGG + Intronic
967956371 3:194880572-194880594 CCCCTGCCTGGCCTGAAACTTGG + Intergenic
969361382 4:6666264-6666286 TCCTTGCCTCTCCTGCACCTCGG + Intergenic
972289058 4:37674036-37674058 TTCATTCATAGCCTGAAACTTGG - Intronic
972680714 4:41304436-41304458 TGCATGCCAAGCATTCAACTAGG + Intergenic
972906296 4:43752036-43752058 TCCATGCCTAACCTATTACTTGG + Intergenic
975343094 4:73263112-73263134 TCCATGCCTCTCTTGCAATTAGG + Intergenic
980297097 4:130934888-130934910 TACATACATAGCCTGCAGCTGGG - Intergenic
987688706 5:21239582-21239604 TCCCTGTCCATCCTGCAACTGGG + Intergenic
992789469 5:80200802-80200824 ACCATGCCTGGCCTGAAACTAGG - Intronic
999865298 5:155694576-155694598 CTCATGCCTAGCCTCCATCTAGG + Intergenic
1001821602 5:174714575-174714597 ACCGTACCTGGCCTGCAACTTGG + Intergenic
1002879946 6:1242440-1242462 TCCCTGCCTCCCCTGCAACTAGG + Intergenic
1007989791 6:46243313-46243335 TCCATTCCTTGCCAGCAATTTGG - Intronic
1009994026 6:70879601-70879623 TCCCTGACAAGCCTGCACCTGGG - Intronic
1014905485 6:127021821-127021843 TCTATTCCCAGCGTGCAACTGGG + Intergenic
1018047397 6:159977834-159977856 CCCACGCCTAGCCTACAACACGG - Intronic
1018047402 6:159977864-159977886 CCCACGCCTAGCCTACAACACGG - Intronic
1018047407 6:159977894-159977916 CCCACGCCTAGCCTACAACACGG - Intronic
1019735108 7:2646699-2646721 TCCATGCCTCACCTACAAGTCGG + Intronic
1021566131 7:22018259-22018281 TCAATGCCTACCCAGCAACATGG - Intergenic
1022334090 7:29406435-29406457 AGCATGCCTGGCCTGGAACTGGG - Intronic
1023677282 7:42643543-42643565 TCCATGCTCAGCCCGCAGCTGGG - Intergenic
1024050372 7:45617371-45617393 TCCATGCCTAGCCTGCAACTCGG - Intronic
1031316161 7:120260302-120260324 TGCATGACTAGCCTCCAGCTAGG - Intergenic
1033489997 7:141833936-141833958 TCAATACATAGCCTGCCACTTGG - Intergenic
1036965484 8:13292931-13292953 ACCATGACTGGCCTGCAATTTGG - Intronic
1039048103 8:33468313-33468335 GCCTTGCCTCTCCTGCAACTAGG - Intronic
1043662208 8:82758106-82758128 TCTGTGCTCAGCCTGCAACTGGG + Intergenic
1046006513 8:108492855-108492877 ACCATGCCTGGCCTGCAGATTGG - Intergenic
1047796113 8:128257596-128257618 ACCATGCCCGGCCTTCAACTGGG - Intergenic
1048444140 8:134480747-134480769 TCCTTTCCTGGCCTGCAAATTGG + Intronic
1049631319 8:143659652-143659674 ACCATACCTGGCCTGAAACTGGG + Intergenic
1050647726 9:7739687-7739709 CCCATGCCCACCCTGCAGCTAGG + Intergenic
1051411818 9:16797572-16797594 TGCATACCTAGCCTCCAGCTAGG - Intronic
1051413155 9:16811597-16811619 TCCATGTCTAGCCTTCACATGGG - Intronic
1053070019 9:35095722-35095744 ACCATGCCCAGCCTGGAAATAGG - Intronic
1054806575 9:69401547-69401569 ACTATGCCTAGCCTGAGACTGGG + Intergenic
1058261825 9:102842922-102842944 TCCATGCACAGACTGCAAATCGG - Intergenic
1058818480 9:108707228-108707250 TCCTTGACTATCCTGCAACCTGG + Intergenic
1189107828 X:38255750-38255772 TCCATGCTTAGCCAGCAGGTGGG - Intronic
1189365841 X:40387783-40387805 TCCATGCTTAGCCAGCAGGTGGG - Intergenic
1189775655 X:44468305-44468327 TCCATGCCTGCCCTGCAGCGAGG + Intergenic
1190079092 X:47341243-47341265 ACCATGCCCAGCCTGAAAATGGG + Intergenic
1194575189 X:95604367-95604389 TCCGTGCCTTCCATGCAACTTGG - Intergenic
1199571951 X:149275012-149275034 GACAATCCTAGCCTGCAACTTGG + Intergenic