ID: 1024050376

View in Genome Browser
Species Human (GRCh38)
Location 7:45617397-45617419
Sequence ACAGCTGACCCTTCAGACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 168}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024050376_1024050382 3 Left 1024050376 7:45617397-45617419 CCTAGGTCTGAAGGGTCAGCTGT 0: 1
1: 0
2: 0
3: 7
4: 168
Right 1024050382 7:45617423-45617445 AGGTGGGACTGGGATGAGAGAGG No data
1024050376_1024050384 26 Left 1024050376 7:45617397-45617419 CCTAGGTCTGAAGGGTCAGCTGT 0: 1
1: 0
2: 0
3: 7
4: 168
Right 1024050384 7:45617446-45617468 GATGTGTTTACCCCATCTGCTGG No data
1024050376_1024050381 -7 Left 1024050376 7:45617397-45617419 CCTAGGTCTGAAGGGTCAGCTGT 0: 1
1: 0
2: 0
3: 7
4: 168
Right 1024050381 7:45617413-45617435 CAGCTGTGATAGGTGGGACTGGG No data
1024050376_1024050383 4 Left 1024050376 7:45617397-45617419 CCTAGGTCTGAAGGGTCAGCTGT 0: 1
1: 0
2: 0
3: 7
4: 168
Right 1024050383 7:45617424-45617446 GGTGGGACTGGGATGAGAGAGGG No data
1024050376_1024050380 -8 Left 1024050376 7:45617397-45617419 CCTAGGTCTGAAGGGTCAGCTGT 0: 1
1: 0
2: 0
3: 7
4: 168
Right 1024050380 7:45617412-45617434 TCAGCTGTGATAGGTGGGACTGG 0: 1
1: 0
2: 1
3: 18
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024050376 Original CRISPR ACAGCTGACCCTTCAGACCT AGG (reversed) Intronic
900249225 1:1658595-1658617 ACAGCTGCACCTTGAGACCGGGG + Intronic
900260173 1:1723939-1723961 ACAGCTGCACCTTGAGACCGGGG + Intronic
902636362 1:17737350-17737372 ACAGCTGACCCCTGTGACATGGG + Intergenic
903778171 1:25806335-25806357 ACAGCTTTCTCATCAGACCTGGG + Intronic
904442642 1:30541613-30541635 ACTGCTGACCCCTATGACCTTGG + Intergenic
904833607 1:33320936-33320958 CCAGCTGAGCCTCCAGTCCTGGG - Intronic
905014051 1:34764967-34764989 ACAGGTGACCCCTGAGGCCTTGG - Intronic
905278744 1:36835712-36835734 TCAGCTGCTCCTTCTGACCTCGG + Intronic
905939851 1:41854307-41854329 ACCCGTGGCCCTTCAGACCTGGG - Intronic
908129272 1:61058457-61058479 ACAGCTGACCCTCAAGTCTTTGG - Intronic
910599380 1:89014498-89014520 ACAGGTGTCCCCTCTGACCTTGG + Intronic
910603694 1:89059268-89059290 ACAGGTGTCCCCTCTGACCTTGG + Intronic
913519756 1:119633466-119633488 TCAGCTGACCCTACAGATTTTGG - Intronic
915147252 1:153802479-153802501 ACTGCTGACCCTTCCTACCCGGG + Intergenic
918025481 1:180740837-180740859 AAAGCAGGCCCTTCAGACATGGG - Intronic
923319856 1:232820476-232820498 CCACTTGACCTTTCAGACCTAGG + Intergenic
924413169 1:243828438-243828460 ACAGCTGACCCTTAATAACATGG + Intronic
1062973891 10:1669130-1669152 CCACCTCACCCTGCAGACCTGGG - Intronic
1064178041 10:13092429-13092451 ACAGCCAACCCTTCAAAACTTGG + Intronic
1065693191 10:28356139-28356161 CCAGCTGACTCTTCATTCCTGGG - Intergenic
1066434315 10:35382972-35382994 ACAGCTGACCCTGAACACCTTGG + Intronic
1066510204 10:36087209-36087231 CCAGCTAACCCTGCAGACCTTGG + Intergenic
1067499829 10:46793396-46793418 ACAGCTGCCACTGCAGACCAAGG - Intergenic
1067594802 10:47546929-47546951 ACAGCTGCCACTGCAGACCAAGG + Intronic
1067641910 10:48055039-48055061 ACAGCTGCCACTGCAGACCAAGG + Intergenic
1068097071 10:52504752-52504774 ACTGCTGACTCTTCAGACTCTGG - Intergenic
1070514704 10:77193801-77193823 TCAGCTCTCCATTCAGACCTGGG - Intronic
1073150027 10:101305191-101305213 ACAGATGAACCTTCAGACAGGGG - Intergenic
1074196057 10:111186417-111186439 ACAGCTTGCCCATCAGTCCTTGG - Intergenic
1074564255 10:114562719-114562741 AGACCTCACCATTCAGACCTGGG + Intronic
1074688126 10:115978370-115978392 ACACATGACCCTTCAGAACCTGG - Intergenic
1075720451 10:124583047-124583069 ACAGTTGACCCTTAACAACTGGG - Intronic
1075735609 10:124662899-124662921 ACAGCTGGCCCTTGAGGCCAGGG - Intronic
1076408758 10:130231248-130231270 ACAGATGCCCCTCCAGGCCTCGG - Intergenic
1076872240 10:133199796-133199818 ACAGCTTTCCCATCGGACCTGGG + Intronic
1076908941 10:133378012-133378034 ACAGCTGGCCCTGCTGACCCGGG + Intergenic
1079141230 11:17811094-17811116 AAAGCTGAATCTTCAGATCTGGG + Intronic
1083255033 11:61490563-61490585 ACAGCTGAGCCCTGAGCCCTTGG + Exonic
1083780139 11:64913508-64913530 AGAGCTGCCCCATCACACCTAGG + Intronic
1083869180 11:65476713-65476735 ACAGCAGGCCCTTCAGGACTTGG - Intergenic
1086089682 11:82993034-82993056 ACAGTTGGCTCTTCAGAGCTGGG - Intronic
1086457610 11:86974827-86974849 CCAGCTTACCCTGCAGAGCTTGG + Intergenic
1095964196 12:47855928-47855950 ACAGGTCACCCTTCAGCCCCAGG + Intronic
1098486923 12:71032204-71032226 AGGTCTGCCCCTTCAGACCTAGG + Intergenic
1102904290 12:116662432-116662454 ACTGAGGCCCCTTCAGACCTGGG - Intergenic
1102925773 12:116825076-116825098 GCAGCTGACGCATCAGACCTGGG - Intronic
1107040502 13:35942820-35942842 TCATCTGACCCTTCACACTTAGG - Intronic
1111171760 13:84535708-84535730 ACAGCTGACTCCACAGACCAGGG - Intergenic
1112569300 13:100579534-100579556 ACAGCTGGCCATAAAGACCTTGG + Intronic
1115519225 14:34216325-34216347 ATAGCTGACCCTTAAAAGCTTGG - Intronic
1116091252 14:40309566-40309588 ACAACTGCTCCTTCTGACCTTGG - Intergenic
1119828202 14:77675806-77675828 ACACCTTTCCCTTCTGACCTGGG - Exonic
1121979539 14:98442620-98442642 AGACCTGACCCTTCAAACCCAGG - Intergenic
1122291427 14:100682327-100682349 ACAGATGATTCCTCAGACCTGGG - Intergenic
1122306858 14:100772039-100772061 ACCCCTGCCCCTTCAGGCCTTGG - Intergenic
1123193453 14:106593197-106593219 CCAGCTGACCCTGCAGCTCTGGG - Intergenic
1123199004 14:106643656-106643678 CCAGCTGACCCTGCAGCTCTGGG - Intergenic
1125521538 15:40350532-40350554 ACATCTGACAATTCAGGCCTGGG + Intergenic
1125691362 15:41598756-41598778 AAAGATGCCCCTTCTGACCTTGG - Intergenic
1127792853 15:62413634-62413656 GCACCTGTCCCTGCAGACCTTGG - Intronic
1128318651 15:66677665-66677687 ACAGGTGCCCCTTCAGTCCACGG - Intronic
1128970895 15:72105045-72105067 TCTACTGTCCCTTCAGACCTAGG + Intronic
1130842873 15:87717989-87718011 ACTGGTAACTCTTCAGACCTGGG + Intergenic
1130876245 15:88017309-88017331 ACAGCTCCCCCTTTAGACCTAGG + Intronic
1131123050 15:89835016-89835038 AGGGCTGGCCCTTCAGATCTGGG - Exonic
1131345536 15:91644328-91644350 ACAGCTGACCCTTACAACATGGG + Intergenic
1134848053 16:17457731-17457753 ACAGCTGCCCCTTTTGAGCTAGG + Intronic
1136098366 16:27974949-27974971 TCCCCTGCCCCTTCAGACCTGGG - Intronic
1138459730 16:57141125-57141147 ACAGCTGCACCTGCAGAGCTGGG + Intronic
1138755440 16:59478726-59478748 ACAGCTGCACCCTCAAACCTGGG - Intergenic
1141165003 16:81654424-81654446 GCAGCTGACCCTTAAGTGCTAGG + Intronic
1142698212 17:1645027-1645049 AGAGGTGCCCCTTCAGGCCTGGG + Intronic
1144233287 17:13230907-13230929 ACAATTGACACTTCAGACTTTGG - Intergenic
1144617244 17:16787963-16787985 ACAGCTGACCCTTGAGGACCGGG - Intronic
1144895454 17:18527710-18527732 ACAGCTGACCCTTGAGGACCGGG + Intergenic
1145136765 17:20416520-20416542 ACAGCTGACCCTTGAGGACCGGG - Intergenic
1145921990 17:28616544-28616566 ACAGCTGAGACTTCAGAACGAGG - Intronic
1146811664 17:35908830-35908852 TCAACTCAGCCTTCAGACCTGGG - Intergenic
1146830334 17:36063530-36063552 CCAGCTCACCCTGCAGATCTTGG + Intergenic
1147232821 17:39031452-39031474 ACAGCTCAACCTTTGGACCTGGG + Intergenic
1147789838 17:43006904-43006926 AGAGCTGAGGCTTCAGAGCTGGG - Exonic
1148219640 17:45852355-45852377 ACAGCTGGACTTTGAGACCTGGG + Intergenic
1149226006 17:54472149-54472171 CCCTTTGACCCTTCAGACCTAGG - Intergenic
1150611693 17:66738751-66738773 ACAGCCGATCCTGCAGACCAAGG - Exonic
1150755620 17:67909757-67909779 ACAGCTGACTCTCCTTACCTTGG - Exonic
1151200424 17:72463884-72463906 CCAGCTGATCCTTCGGTCCTGGG - Intergenic
1152055208 17:78019352-78019374 GCTGCTGTCCCTTCAGACTTTGG - Intronic
1153264521 18:3256849-3256871 ACAGCTGAACCTGCATGCCTGGG + Intergenic
1153435688 18:5065658-5065680 ACAGCTGATCCTTAAGTCCAGGG + Intergenic
1157760996 18:50265794-50265816 AGAAGTGTCCCTTCAGACCTGGG - Intronic
1159884629 18:73892169-73892191 CCAGGTGACACTTCAGACCCAGG + Intergenic
1160734004 19:653557-653579 CCAGCAGGCCCTTCAGCCCTGGG - Intronic
1166267501 19:41694360-41694382 ACAGCTGTCCCCCCAGACCATGG - Intronic
1168259597 19:55186025-55186047 AAAGCAGACCCCACAGACCTGGG - Intronic
924986074 2:271228-271250 ACAGTTGACCCTTCAGCCACAGG + Intronic
925217323 2:2108351-2108373 ACAGCTTACCCTTCATACAGGGG + Intronic
925783645 2:7407124-7407146 ACAGCCAAGCCTTCAGACATAGG + Intergenic
926684827 2:15690605-15690627 GCACCTGGCCCTTCAGCCCTGGG - Intergenic
931816079 2:65902049-65902071 TCTGCTGTCCCTCCAGACCTAGG + Intergenic
935145123 2:100390368-100390390 ACAGCCGACCCGCCATACCTTGG + Intergenic
935319837 2:101875698-101875720 ACAGATGACCCTACATTCCTAGG - Intronic
935914365 2:107933494-107933516 AGAGCTGGCTCTTCAGAACTGGG + Intergenic
938688484 2:133764175-133764197 ACAGCTGAGCCTTCATAGGTAGG + Intergenic
943071948 2:183152003-183152025 ACAGTTGTCCCTTTAGACTTAGG + Intronic
947965717 2:234279929-234279951 ACAGCTGGCCCTTCAGGCACAGG - Intergenic
948170321 2:235896405-235896427 ACAGATAACTCTTCAGAGCTTGG + Intronic
948593626 2:239066167-239066189 ACAGCTGGCCTCTGAGACCTGGG - Intronic
948628652 2:239286500-239286522 ACAGCTGACTCTGCAGGACTGGG + Intronic
1169324582 20:4664929-4664951 GCAGCTGACCCTGCAGGTCTGGG - Intergenic
1172062522 20:32196350-32196372 GCAGCTGAGCTTTCAGAGCTGGG - Exonic
1172996091 20:39071518-39071540 CCAACTCACCCTGCAGACCTTGG - Intergenic
1173647443 20:44642249-44642271 TCTGCAGACCCCTCAGACCTGGG + Intronic
1174483676 20:50848290-50848312 ACTCCTGACCCCTCAGACCTGGG - Intronic
1177407369 21:20687305-20687327 ACAGATGAAACTACAGACCTGGG + Intergenic
1181263225 22:21613711-21613733 ACAGCTGACTGTTCATTCCTGGG + Intronic
1181820801 22:25473998-25474020 ACAGTTGACCCTTCAAATATGGG - Intergenic
1182827461 22:33278112-33278134 TCATGTGACCCTTTAGACCTGGG + Intronic
1183541229 22:38430587-38430609 AATGCTGGCCCTTCAGAGCTGGG + Intronic
1183660025 22:39214187-39214209 ATAGCTGTCCCTTCTGACTTAGG - Intergenic
1184405302 22:44297488-44297510 ACAGCAGACCCTTCGTTCCTTGG + Intronic
1184947961 22:47817817-47817839 ACATCTCACCCATCAGGCCTGGG + Intergenic
949903511 3:8839134-8839156 ACAGCTGGAACTTCAAACCTGGG - Intronic
949926237 3:9044145-9044167 AAAGCTGACCCAAAAGACCTTGG + Intronic
954870687 3:53765271-53765293 ACAGCTGACCCCTCAGCTCAGGG - Intronic
955127560 3:56128764-56128786 AGAGCTGACCCTTCTGGCCCTGG + Intronic
960767286 3:121148026-121148048 CCAGCTCACCCTGCAGATCTTGG + Intronic
962704111 3:138026895-138026917 AGAGCTGAGCTTTCATACCTCGG + Intronic
965074070 3:163953844-163953866 TCAGCTGCCCCTGCAGACCCAGG - Intergenic
965622439 3:170655050-170655072 ACAGTGAACCCTTCAGACTTGGG + Intronic
967945192 3:194798500-194798522 ACAGCTGACCTTTCAGAGACAGG - Intergenic
969626451 4:8308021-8308043 ACCGCTGACCCTCCAGATTTGGG - Intergenic
970193435 4:13535333-13535355 ACAGCTGACCGCTCAGGCCCAGG + Intergenic
970395564 4:15661853-15661875 AAAGCAGATCCTTCAGTCCTAGG - Intronic
970447617 4:16137101-16137123 CCAGCTGAGGCCTCAGACCTGGG + Intergenic
971496152 4:27267523-27267545 ACATTTGGCCCTTCAAACCTAGG - Intergenic
971776156 4:30968452-30968474 ACAGCTCAGCCTTCAAACCAAGG + Intronic
976117718 4:81745661-81745683 TCAGTTGACCCTTCAGACACTGG - Intronic
984257521 4:177406472-177406494 AGAGATGACCCTTCAGATTTTGG - Intergenic
992144058 5:73827098-73827120 AGAGCTCATCCTTCAGTCCTTGG + Intronic
994031781 5:95151491-95151513 ACAGTTGACCCTTGAGAACATGG - Intronic
995091970 5:108188753-108188775 ACAGCTCACCTTTGAGCCCTGGG - Intronic
995877845 5:116809701-116809723 ACAGGTGACCCTCTAGCCCTTGG + Intergenic
996176657 5:120368148-120368170 ACAGCTGTGACTCCAGACCTGGG + Intergenic
996603741 5:125296613-125296635 TCAGCTGCTCCTCCAGACCTTGG + Intergenic
998900555 5:146848748-146848770 ACAGCTCACCCTTAAGGCTTAGG + Intronic
999432507 5:151536459-151536481 GCAGCTGGCCCTTGTGACCTGGG + Intronic
1002152278 5:177244107-177244129 GCAGCTGACAATTCAGACTTTGG + Intronic
1002557019 5:180050221-180050243 CCAGCTCACCCTGCAGAGCTTGG - Intronic
1013747253 6:113360047-113360069 AGAGCTAAGCCTTCAGCCCTGGG - Intergenic
1013986564 6:116200945-116200967 ACAGAGAACCTTTCAGACCTTGG - Intronic
1021787145 7:24163783-24163805 AGAGCTGAAGCTCCAGACCTTGG + Intergenic
1022271585 7:28812886-28812908 GCAGCTGGCCATCCAGACCTTGG - Intronic
1022519881 7:30999271-30999293 AAACCTGACCCCTAAGACCTGGG - Intergenic
1024050376 7:45617397-45617419 ACAGCTGACCCTTCAGACCTAGG - Intronic
1027615416 7:80417400-80417422 ACATCTCATCCTTCAGACATCGG - Intronic
1029050356 7:97680363-97680385 ACAGCTGCAGCTTCATACCTTGG - Intergenic
1030209510 7:106982173-106982195 ACAGCTTACCTTTCAGACAGTGG - Intergenic
1032092229 7:128916603-128916625 CCTGCGGACCCTTCAGAGCTGGG - Intergenic
1034401496 7:150864493-150864515 AGAGCTGACCTTCCAGGCCTGGG - Intergenic
1034617219 7:152428807-152428829 ACAACTGACACTTTAGACCTTGG - Intronic
1036798434 8:11772220-11772242 AGAGCAGAACCTTCAGATCTAGG + Intronic
1037411765 8:18605507-18605529 TCAGATGACACTTCAGACTTTGG + Intronic
1041636894 8:60155038-60155060 ACACCTGACCATCCAGACCATGG - Intergenic
1041982048 8:63873461-63873483 CCTGCTGCCCCTTCAGGCCTAGG - Intergenic
1045012094 8:97967382-97967404 CCAGATGACACTTCAGACTTTGG - Intronic
1047318455 8:123755484-123755506 TCAGCTGCAGCTTCAGACCTTGG - Intergenic
1047765462 8:127986526-127986548 CCACCTGACCCTTCAGTCCCAGG + Intergenic
1049787453 8:144457750-144457772 TCAGCTGACCATAGAGACCTTGG - Intronic
1050452943 9:5803121-5803143 ACAGCTTTCCCTTCAGTCCTTGG - Intronic
1057954545 9:99397099-99397121 ACAGCTTAACCGTAAGACCTCGG + Intergenic
1062368698 9:136225229-136225251 ACAGCTAACCATTAAGACATAGG - Intronic
1062457444 9:136646329-136646351 TCAGCTAACCCTCCAGACCCCGG + Intergenic
1187488403 X:19726091-19726113 ACAGCTTACACTTCAGAAGTTGG + Intronic
1194411739 X:93566061-93566083 ACAGCTGACCCTGAAGGGCTGGG - Intergenic
1195049259 X:101081859-101081881 ACAGCTTACCTTTCTGGCCTTGG - Intronic
1196139751 X:112247901-112247923 AAAGCTGACCTTGCAGAACTGGG + Intergenic