ID: 1024050381

View in Genome Browser
Species Human (GRCh38)
Location 7:45617413-45617435
Sequence CAGCTGTGATAGGTGGGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024050376_1024050381 -7 Left 1024050376 7:45617397-45617419 CCTAGGTCTGAAGGGTCAGCTGT 0: 1
1: 0
2: 0
3: 7
4: 168
Right 1024050381 7:45617413-45617435 CAGCTGTGATAGGTGGGACTGGG No data
1024050372_1024050381 19 Left 1024050372 7:45617371-45617393 CCGAGTTGCAGGCTAGGCATGGA 0: 1
1: 0
2: 3
3: 17
4: 137
Right 1024050381 7:45617413-45617435 CAGCTGTGATAGGTGGGACTGGG No data
1024050369_1024050381 26 Left 1024050369 7:45617364-45617386 CCTGGGGCCGAGTTGCAGGCTAG 0: 1
1: 0
2: 1
3: 11
4: 79
Right 1024050381 7:45617413-45617435 CAGCTGTGATAGGTGGGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024050381 Original CRISPR CAGCTGTGATAGGTGGGACT GGG Intronic
No off target data available for this crispr