ID: 1024050878

View in Genome Browser
Species Human (GRCh38)
Location 7:45622554-45622576
Sequence GTAAACATCTGTACATCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024050878 Original CRISPR GTAAACATCTGTACATCTCT AGG Intronic
902047312 1:13535383-13535405 GTCACTATCTGTACAGCTCTGGG + Intergenic
902239558 1:15079570-15079592 GTGTGCATCTGTACAGCTCTTGG - Intronic
903463018 1:23532137-23532159 GTAAATGTTTGAACATCTCTAGG + Intergenic
908886379 1:68793891-68793913 AGACACATCTGTACATCTGTGGG - Intergenic
908958503 1:69666144-69666166 TGAACCATCTGTACATCCCTGGG + Intronic
909092804 1:71247649-71247671 GTAAACATCTGAACCCCACTGGG - Intergenic
909404629 1:75274046-75274068 CTTAAAATCTGTATATCTCTTGG + Intronic
909406357 1:75294289-75294311 ATAACCATCTGTACCTCACTAGG - Intronic
909995493 1:82274074-82274096 ATCAACAGCTGTACATCTTTTGG - Intergenic
910675387 1:89811210-89811232 GTGAACTTCTGTTCATCTTTTGG + Intronic
913000143 1:114572244-114572266 TTAAACAGCTGTGCCTCTCTAGG + Intronic
917094938 1:171390571-171390593 GTACACATCTGAACATCTGAAGG - Intergenic
918611574 1:186498280-186498302 GTAAATATTTGTTCATCTCTTGG + Intergenic
920567902 1:206990405-206990427 ATAAACATCTGTACCTCAGTGGG + Intergenic
922236280 1:223724999-223725021 ATAAACATCTGTAAATATCAGGG + Intronic
922396657 1:225209063-225209085 TTCAACATCTGGCCATCTCTGGG + Intronic
923308109 1:232707162-232707184 TTAAACATCTTTACATCATTGGG + Intergenic
924071257 1:240282237-240282259 CTAACCAGCTGTGCATCTCTTGG - Intronic
1064979639 10:21153138-21153160 GTAAACCTCTCAACAACTCTTGG + Intronic
1070868304 10:79724100-79724122 GTAAACATAAGTACATTTGTTGG + Intergenic
1071635217 10:87246300-87246322 GTAAACATAAGTACATTTGTTGG + Intergenic
1071660029 10:87491694-87491716 GTAAACATAAGTACATTTGTTGG - Intergenic
1074473110 10:113745096-113745118 TTAAAAATATATACATCTCTTGG + Intergenic
1074559353 10:114521269-114521291 GTAATCATCTGTACGCCTTTCGG + Intronic
1079137171 11:17782165-17782187 GTAGAAACCTGTACATTTCTGGG + Exonic
1081476462 11:43437767-43437789 GTAAACATCTGTTCAGTTCAAGG + Intronic
1087847527 11:102990239-102990261 GTGGACACCTGTACATCCCTGGG + Intergenic
1088068350 11:105749515-105749537 GTAAAATTCAGCACATCTCTTGG + Intronic
1088714664 11:112538458-112538480 GTAACCATCGTTACATCTTTAGG - Intergenic
1090264265 11:125344174-125344196 GTAAGCTTCTGCTCATCTCTAGG + Intronic
1090618043 11:128534081-128534103 GTAAACATGTGTGCATGTGTAGG - Intronic
1091066392 11:132517261-132517283 CTAAAAATCTCTACATCCCTAGG - Intronic
1091550784 12:1533596-1533618 CTAACCTTCTGTCCATCTCTGGG + Intronic
1092578963 12:9819246-9819268 TTAGACATCTCTACATCCCTAGG + Intergenic
1095134983 12:38589688-38589710 GAAAACATTATTACATCTCTAGG - Intergenic
1097392776 12:59035852-59035874 CTAAACAACTGCACTTCTCTTGG - Intergenic
1098887013 12:75970410-75970432 ATATTCATCTCTACATCTCTAGG + Intergenic
1099622075 12:85015732-85015754 GGAATCACCTGTACAACTCTTGG + Intronic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1101526117 12:105532738-105532760 TTAAATATCTGTACATCTCTTGG - Intergenic
1102631419 12:114284098-114284120 GCAAAGAACTGTACCTCTCTGGG + Intergenic
1105382918 13:19904029-19904051 TTAAACATATGTTCTTCTCTTGG - Intergenic
1105679610 13:22713057-22713079 GGAGACATCTGAATATCTCTGGG + Intergenic
1107193706 13:37621842-37621864 GTACACATGTGTGCATCCCTAGG - Intergenic
1110893687 13:80722346-80722368 GTAAACATCTCAACATATGTTGG + Intergenic
1111540840 13:89665321-89665343 GGACACATCTGAACATCTGTAGG + Intergenic
1112536671 13:100264692-100264714 ATGAACATATATACATCTCTAGG + Intronic
1114273718 14:21122329-21122351 CTAAAGATCTCAACATCTCTGGG - Intergenic
1119048492 14:71342460-71342482 TTAAAAATCTGTATATTTCTAGG - Intronic
1119515694 14:75246558-75246580 CTAGGCATCTGTCCATCTCTGGG + Intronic
1122078323 14:99249676-99249698 GTAAATAACTTAACATCTCTGGG + Intronic
1125992128 15:44120017-44120039 TGAACTATCTGTACATCTCTGGG - Intronic
1130055475 15:80520283-80520305 GTAAACCTCTGTTTACCTCTGGG + Intronic
1131440470 15:92455752-92455774 GCAAACATATGCACATCTATAGG + Intronic
1131859425 15:96636656-96636678 GTAAACATCTGGAGATTTTTCGG + Intergenic
1139162355 16:64526506-64526528 CTAAACATCTGTGTAGCTCTAGG + Intergenic
1140768148 16:78178947-78178969 GTAAACATTTGACCAGCTCTCGG - Intronic
1142894672 17:2966084-2966106 GTGAACATCAGTGCATCTCAGGG - Intronic
1144242404 17:13325991-13326013 GTAAACCTCTGTTCATCTTATGG - Intergenic
1145122721 17:20275170-20275192 GGGAACATTTGTACATATCTGGG + Intronic
1146421776 17:32693568-32693590 TCAAGCATATGTACATCTCTTGG + Intronic
1148829867 17:50424780-50424802 GTAAACCACTGTCCCTCTCTTGG - Intergenic
1149977832 17:61284435-61284457 GGACACATCTGAACATCTCAAGG + Intronic
1150700765 17:67444977-67444999 ATAAACATCTGTACCCCACTAGG - Intronic
1150854270 17:68735366-68735388 GTCAAAAGCTGTACATCCCTGGG + Intergenic
1155128680 18:22906976-22906998 TTAAACATCAGCACATCACTAGG + Intronic
1157771583 18:50352346-50352368 GTAAACATTTGCATATATCTAGG + Intergenic
1159534081 18:69693163-69693185 GTTAATATTTATACATCTCTTGG + Intronic
1166693680 19:44839836-44839858 CAAAAAATCTGTACATGTCTGGG - Intergenic
924972809 2:145020-145042 GCAAACATCTATTCATCTTTTGG - Intergenic
926118058 2:10225692-10225714 ATGAACATCTGAACCTCTCTTGG - Intergenic
927575588 2:24199621-24199643 TTGACCATCTGTACATTTCTAGG + Intronic
927785714 2:25973251-25973273 GTAAAAAGCTGTACATATTTAGG + Intronic
932716514 2:74103861-74103883 GTAAATACCTGTTCATCTCAGGG - Exonic
933251230 2:80031111-80031133 GTGCACCTCTGTATATCTCTGGG - Intronic
933685780 2:85140206-85140228 GTAAGCATCTGTCCACCACTGGG - Intronic
935024027 2:99258955-99258977 GTAAACATCTTTACACATCAGGG + Intronic
938130168 2:128708345-128708367 TTAACCTTCTGTAAATCTCTAGG + Intergenic
938156625 2:128946941-128946963 CTAAATCTCTGTAGATCTCTGGG + Intergenic
943673387 2:190689995-190690017 GTATAGATGTATACATCTCTGGG - Intronic
948663547 2:239521029-239521051 GCAAACATGTGTACTTCTCAGGG - Intergenic
1169554338 20:6733802-6733824 GTATACATCTGTACTTTTCCAGG - Intergenic
1170498465 20:16950017-16950039 GTAAACAAGTGTCCATCTCAAGG + Intergenic
1172439111 20:34953077-34953099 GTACACCTCTGTATGTCTCTGGG - Intronic
1173787477 20:45804903-45804925 GTAATTATCTGTACATATGTTGG + Intronic
1174599266 20:51711217-51711239 TTAAAAATATGCACATCTCTGGG - Intronic
1179075590 21:38118405-38118427 CTTAACAACTGTACAACTCTGGG + Intronic
1180358870 22:11867441-11867463 ATAGATATCTGTACAGCTCTTGG + Intergenic
950736880 3:15016541-15016563 GTTAACATTTGTACAGCACTTGG + Intronic
952562777 3:34614685-34614707 GTAACCATTAGTACAGCTCTAGG + Intergenic
956625810 3:71265678-71265700 GTGAACATGTGTACATTACTAGG - Intronic
958709386 3:97698576-97698598 GTAAAGCTCTGTACATTTATAGG + Intronic
958767208 3:98383615-98383637 TTAAACATCTTTGCATCGCTGGG + Intergenic
960517843 3:118621779-118621801 GTAAATATGTGTACTTGTCTTGG + Intergenic
966710334 3:182966191-182966213 GTAAACACCTGTTAATCTCATGG - Intronic
967547861 3:190753056-190753078 TTTACCATCTGTACATCTTTTGG + Intergenic
971322032 4:25613423-25613445 GTACACATCTGAACATCTGAAGG - Intergenic
971533696 4:27721374-27721396 GTACACATCTGAACATCTGAAGG - Intergenic
971810197 4:31415309-31415331 GTAAACATTTTTATATTTCTTGG - Intergenic
972924990 4:43993077-43993099 GTACATATGTGGACATCTCTTGG + Intergenic
973924243 4:55721053-55721075 GAAAATATCTGTACATTCCTGGG - Intergenic
976650266 4:87426374-87426396 GTAAACTTATTTACCTCTCTGGG + Intronic
977634697 4:99283680-99283702 GCAAATATCTTTATATCTCTGGG + Intronic
978863407 4:113478332-113478354 GTAAACATCTGTACCTGAGTTGG - Intronic
978874302 4:113620187-113620209 GAAAACATCTGTCCATCCCTTGG + Intronic
979195973 4:117920318-117920340 GTAGACATCTGCATATCTTTTGG + Intergenic
979655508 4:123188637-123188659 GAAAAGATCAGTACATCTCAAGG - Intronic
979909778 4:126348530-126348552 GAAAACATCTGTGCATGTCTAGG - Intergenic
980809315 4:137854323-137854345 GGACACATCTGTACATCTGAAGG + Intergenic
983929712 4:173439959-173439981 GTCAACTTGTGAACATCTCTAGG + Intergenic
984857466 4:184207178-184207200 TTCAGCATCTGTTCATCTCTTGG + Intronic
986333285 5:6733894-6733916 GTAAACATTTTTACATTTTTTGG - Intronic
986612087 5:9579047-9579069 AGAAACATCTTGACATCTCTGGG - Intergenic
986832222 5:11592563-11592585 GTAAACATTTTTGCATCTTTGGG - Intronic
986966876 5:13284279-13284301 GTTAACATCTGTACATCTAATGG + Intergenic
987055015 5:14183035-14183057 GTAGACAACAGTGCATCTCTAGG + Intronic
988854953 5:35219276-35219298 GAATCCATCTGTACAGCTCTGGG - Intronic
989756298 5:44959505-44959527 GTACACATCTGAACATCTGAAGG + Intergenic
990402035 5:55448381-55448403 GTAAACGTCTGCATTTCTCTAGG - Intronic
991038002 5:62147192-62147214 GAAAACATATGTCCATCTCTGGG + Intergenic
991275120 5:64837964-64837986 GTAGACATCTAAAAATCTCTAGG - Intronic
991283657 5:64944471-64944493 GAAAACATCTTTAAATCTCATGG + Intronic
992283614 5:75208864-75208886 ATAAACATCTGGACCTCACTGGG + Intronic
996395846 5:123013047-123013069 GAGAACATCTGTTCAACTCTTGG + Intronic
996854800 5:127993532-127993554 GTAAACACATTCACATCTCTTGG - Intergenic
997155629 5:131553317-131553339 GTAGAAATGTGTTCATCTCTAGG + Intronic
997603819 5:135158292-135158314 GTTAACTCCTGTTCATCTCTTGG + Intronic
999579281 5:153017532-153017554 ATAAACAACTTTACATCTCATGG + Intergenic
1000482740 5:161799980-161800002 TTAAACATATGTACATATTTTGG - Intergenic
1001461330 5:171917217-171917239 TAAAACATATATACATCTCTTGG - Intronic
1001514784 5:172347775-172347797 GGAAACATCTGTGAAGCTCTTGG + Intronic
1001707890 5:173755014-173755036 GCAAACATGTCTACTTCTCTAGG - Intergenic
1003487320 6:6590841-6590863 GTGACCATCTGGACCTCTCTGGG - Intronic
1004030940 6:11868983-11869005 GTAAAAATGTGCTCATCTCTTGG - Intergenic
1004734259 6:18389103-18389125 GTAAATATTTGTAAAACTCTGGG - Intronic
1005141952 6:22642238-22642260 CTAATCATCTTTGCATCTCTAGG + Intergenic
1009307545 6:62109156-62109178 GTAAACAACTTTGCATTTCTAGG - Intronic
1010813451 6:80326899-80326921 GTAAACATCTGTGTGACTCTGGG - Intronic
1012128799 6:95465440-95465462 GTAAAACTGTGTACATCTTTCGG - Intergenic
1012503595 6:99918657-99918679 GTAAACATGTATACATATCATGG + Intergenic
1014116573 6:117674285-117674307 GGAAACATCTGTTCACGTCTTGG - Intergenic
1014236821 6:118966887-118966909 GTAATCATCTGTATATCTTCTGG + Exonic
1015485617 6:133766718-133766740 GTAAATACCTGAACAACTCTAGG - Intergenic
1015912231 6:138180426-138180448 ACAAACATCTGTGCTTCTCTTGG + Intronic
1018663325 6:166109549-166109571 GTTAACATCTGTACATCTTGGGG + Intergenic
1018731359 6:166653535-166653557 GGAGACATCTGTACTTTTCTGGG - Intronic
1019821229 7:3244327-3244349 GAAAACATCTGTACCTTACTAGG + Intergenic
1021369293 7:19821378-19821400 GGAAACATCTTTGCATCTCTGGG + Intergenic
1022369268 7:29755268-29755290 GTATACATTTGCACACCTCTTGG + Intergenic
1024050878 7:45622554-45622576 GTAAACATCTGTACATCTCTAGG + Intronic
1026434082 7:70378847-70378869 TTTAACATCTGTCCATCACTAGG - Intronic
1028059505 7:86293299-86293321 ATAAATATCTGTATATCTGTGGG + Intergenic
1030516655 7:110547012-110547034 GAAAACTTCTGTAAATTTCTAGG + Intergenic
1033450205 7:141455659-141455681 GTTAACATTTGTAAAGCTCTTGG + Intronic
1035273660 7:157734562-157734584 TAAAATATTTGTACATCTCTGGG - Intronic
1037499646 8:19473144-19473166 TCAAAAATCTTTACATCTCTGGG - Intronic
1038526174 8:28275465-28275487 CTAAACATCTTCACATCCCTGGG + Intergenic
1039165364 8:34673433-34673455 ATAAATATCTGTTCATCTCCCGG - Intergenic
1040656018 8:49508770-49508792 GTAAATATTTGTACATCACACGG - Intergenic
1040719335 8:50298151-50298173 GTGATCATTTGTCCATCTCTGGG - Intronic
1043014398 8:74920253-74920275 GAAAACATCTGCATATCTTTTGG + Intergenic
1043992443 8:86772744-86772766 AGAAGCATCTGTACATCTTTAGG - Intergenic
1051103811 9:13553883-13553905 CTATATATCTGTACATCCCTGGG + Intergenic
1055090538 9:72361238-72361260 TAAAACACCTGTACATATCTGGG + Intronic
1055359340 9:75472767-75472789 GTGAATATCTATACATCTCGTGG + Intergenic
1056515658 9:87346790-87346812 GTATACACTTGTACATCTGTTGG + Intergenic
1056691758 9:88813844-88813866 GTTAACATCTTTTCATCTCTGGG + Intergenic
1057401096 9:94724416-94724438 GTAAATATCTGTATATCGATTGG + Intergenic
1058815891 9:108682514-108682536 GCAAACCACTGTACTTCTCTGGG + Intergenic
1058865635 9:109159825-109159847 GCAAACATCAGCTCATCTCTGGG + Intronic
1060134023 9:121134066-121134088 GTGAACATCTGTGAACCTCTTGG + Intronic
1185552179 X:991957-991979 ATAAACCTCTTTAAATCTCTTGG - Intergenic
1186369117 X:8928599-8928621 ATACACATCTGTACATCTCAAGG + Intergenic
1188006226 X:25017307-25017329 ATAAACATCTGCATAACTCTTGG + Intergenic
1188354972 X:29179471-29179493 ATAAACACATGAACATCTCTGGG - Intronic
1188401581 X:29752125-29752147 TTAAAAATTTGTACATCTGTGGG - Intronic
1189146355 X:38659039-38659061 GTATACATGTGTACGTCTGTGGG - Intronic
1195811302 X:108833580-108833602 GTAAACTTCTGTACATTTTTTGG - Intergenic
1196158204 X:112453993-112454015 GAAAACATCTTTACCTCTCTGGG + Intergenic
1197002847 X:121459091-121459113 GTAAACATTTTTATATATCTTGG - Intergenic
1197610997 X:128638019-128638041 GTAAACATGTGTAAAGCCCTAGG + Intergenic
1198567591 X:137920668-137920690 GGAAACATCTCTACAAGTCTTGG - Intergenic
1198740282 X:139835030-139835052 GCAAACATGTCTACATATCTGGG + Intronic
1199407183 X:147476209-147476231 TTAAACACCTCTACATCGCTTGG + Intergenic
1202018757 Y:20441586-20441608 GTTACCATCTTTATATCTCTGGG + Intergenic