ID: 1024052711

View in Genome Browser
Species Human (GRCh38)
Location 7:45638972-45638994
Sequence TCCCATGTGGTCCTACTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 105}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024052711_1024052716 26 Left 1024052711 7:45638972-45638994 CCATGAAGTAGGACCACATGGGA 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1024052716 7:45639021-45639043 TAAGTCTGAGGCCCTTGTGTTGG 0: 1
1: 0
2: 2
3: 6
4: 183
1024052711_1024052715 14 Left 1024052711 7:45638972-45638994 CCATGAAGTAGGACCACATGGGA 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1024052715 7:45639009-45639031 ATAAACTTGTCATAAGTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024052711 Original CRISPR TCCCATGTGGTCCTACTTCA TGG (reversed) Intronic
902793530 1:18785168-18785190 TCCCATGTGGTGCTAGGACAAGG - Intergenic
904002168 1:27345049-27345071 TCCTGTGTGGCCCTACCTCAGGG + Exonic
905615597 1:39395579-39395601 TCCTTTGTGGACATACTTCAGGG + Intronic
906161649 1:43653694-43653716 TCCCATGTGGACTTTCTTCAAGG + Intronic
911229090 1:95341089-95341111 TCCCCTGGGGTCTTACTTTAAGG + Intergenic
912958710 1:114175889-114175911 TCCAAAATGGTCGTACTTCAAGG + Intergenic
912967987 1:114253053-114253075 TCTCATGTGATCCCACTCCAAGG - Intergenic
915078415 1:153331682-153331704 TTGCATGTCATCCTACTTCAGGG - Intronic
916215621 1:162390591-162390613 TCCTATGTGTTCCTCCATCACGG + Intergenic
918005757 1:180540791-180540813 TCCCCTGTGATCCCATTTCATGG + Intergenic
920272703 1:204778205-204778227 TCCCCTGTGGTCATATTTCAGGG + Intergenic
921622711 1:217343816-217343838 TCAGAAGTGGTCCTAATTCAGGG - Intergenic
924246565 1:242091340-242091362 TCCCATGTAGTCCATCTTCAAGG + Intronic
1063709674 10:8465075-8465097 TGCCATGTGGTGCCACTTCTAGG + Intergenic
1064098008 10:12438293-12438315 TAACATGTGGTCCTTCTCCAAGG - Intronic
1066718279 10:38310470-38310492 TGCCATGTTGTACAACTTCAGGG + Intergenic
1071227003 10:83542351-83542373 TCCTTTGTGGTCCTGCTGCAAGG + Intergenic
1071733073 10:88268449-88268471 TCCCACATGGTCCTATTGCATGG - Intergenic
1072235601 10:93450936-93450958 TCCCATGTGGTATGACTTGAAGG + Intronic
1077296438 11:1828467-1828489 TCCCTTCTGGTCCCACTGCAGGG - Intronic
1079436558 11:20459360-20459382 CACCATATGGTCCTACTTCAGGG - Intronic
1083552150 11:63598045-63598067 TCCCATGTGTTCTTACTTGGAGG + Exonic
1086740057 11:90355719-90355741 CCCCAAGTGCTCCTTCTTCAGGG - Intergenic
1091993041 12:4972392-4972414 TCCAGTGTGTGCCTACTTCAGGG + Intergenic
1095203936 12:39417866-39417888 TCCAATTTGGTCCAACTTCTGGG + Intronic
1098875462 12:75861972-75861994 TCCCAAGTGGTCCTGGTTAAGGG - Intergenic
1104189110 12:126460840-126460862 TCGAATGTGGCCTTACTTCAAGG + Intergenic
1106360210 13:29024652-29024674 TGCCATGCAGTCCTACTTAATGG - Exonic
1110785348 13:79518123-79518145 TCCCATGTCTTCCTACTACATGG - Intronic
1112574695 13:100625118-100625140 TCCCTTGTTCTCCTTCTTCAAGG - Intronic
1122332090 14:100926942-100926964 TCCTATGTGCTCCTCCCTCAAGG - Intergenic
1122334248 14:100958664-100958686 TCACATGTGCTCCTTCCTCAGGG - Intergenic
1125195658 15:37042906-37042928 GCCCATGAGATCCTACTTCATGG - Intronic
1128928951 15:71686533-71686555 TCCCATGTGTTCTGATTTCATGG - Intronic
1129175163 15:73834744-73834766 TCCCATGTGTTCCTCCTTTCAGG + Intergenic
1129255470 15:74331610-74331632 CCCCAGGTGGCCCTTCTTCAGGG - Intronic
1130351458 15:83095773-83095795 TCCCATGTTGTCCTTTTTCTTGG + Intergenic
1139067200 16:63331998-63332020 TCCCATGTGGTATTCCTCCAAGG - Intergenic
1144112481 17:12049584-12049606 TTCCATGTGGTCTTTCATCAAGG + Intronic
1145917521 17:28584275-28584297 TCCCATTTGGTCCTAAATCCTGG + Intronic
1155451256 18:25964773-25964795 TCCCATGTGATTCTGTTTCATGG + Intergenic
1155613249 18:27692940-27692962 AGCCATGGGGACCTACTTCAGGG - Intergenic
1156383834 18:36587971-36587993 ACCCATGTGGTCCAGCCTCAGGG - Intronic
1161868552 19:6852943-6852965 TGCCATGTGGTCCGCCTTCTAGG + Exonic
1164850244 19:31477249-31477271 CCCCCTGTGGTCCTGCTTCTGGG + Intergenic
925444423 2:3915550-3915572 TCCCATGTGGTTTTAAATCATGG - Intergenic
927643449 2:24860264-24860286 TCCCATGTGACCACACTTCAGGG - Intronic
930790588 2:55323622-55323644 TCCCATGAGGTCCTTATTCTAGG + Intronic
931898025 2:66755395-66755417 TCCCATGTTGTTATACTTCCTGG - Intergenic
932885131 2:75542491-75542513 TCCCACTTGGTTCTACTTCTGGG + Intronic
934619698 2:95796670-95796692 CCCCATCTGGTCCTGCTTCCTGG + Intergenic
934641190 2:96027887-96027909 CCCCATCTGGTCCTGCTTCCTGG - Intronic
939217069 2:139251994-139252016 TCCCAAGTATTCCGACTTCAGGG - Intergenic
939802132 2:146722600-146722622 TAGGATGTGGTCTTACTTCAAGG - Intergenic
940324572 2:152411770-152411792 TCCCATGTGGCCAGACTTCTGGG + Intronic
946396365 2:219445576-219445598 TCCCATGTGGGCCTTTTTCTGGG + Intronic
948678909 2:239618526-239618548 TGCCATTTGGTCCTATTTCTTGG + Intergenic
948864419 2:240768137-240768159 TCCCCAGTGGTCCCACTTCTGGG + Intronic
1170076013 20:12419929-12419951 TCCCATGTTATCTTAGTTCAAGG - Intergenic
1170560130 20:17550051-17550073 TCCCGAGTGGTACTACCTCATGG - Intronic
1171435513 20:25119930-25119952 TCCCATGTCTTCCTCCTTCTTGG - Intergenic
1173789485 20:45818511-45818533 TGCCATGTGGTCCTTGGTCACGG + Intergenic
1173860387 20:46279130-46279152 TCCCACGTGGTTTTACTGCAAGG + Intronic
1175448973 20:59046210-59046232 TGCCATCTTGTCATACTTCAAGG + Intergenic
1177054581 21:16285319-16285341 TACAATGCGGTCCTACTTCTAGG - Intergenic
1182072955 22:27476239-27476261 CCCCATGTGGGCCCACTCCATGG - Intergenic
1182930699 22:34171492-34171514 ACCCATGTAGTCTTAGTTCAGGG + Intergenic
1184530167 22:45050473-45050495 TTCCATGTGGTCCTCCCCCATGG - Intergenic
949562641 3:5216570-5216592 TCCCATGTGATCCAAAATCACGG - Exonic
950277394 3:11674256-11674278 TCTCATGTGGTCCTCTTTCCGGG - Intronic
951699275 3:25478520-25478542 ACCCATCTTGCCCTACTTCAGGG + Intronic
954725343 3:52604170-52604192 TTCCTTTTGGTCCTACATCATGG + Intronic
959981248 3:112520134-112520156 TCACATGAGGTGCTACTTCAGGG + Intergenic
961186656 3:124920786-124920808 ATCAATGTGGTCCTACTTCCAGG - Intronic
962922064 3:139959199-139959221 TACTATGTGGTCCCACTTCCTGG + Intronic
964664022 3:159152172-159152194 TACCATGGGGACCTACTTGATGG - Intronic
966079176 3:175978362-175978384 TTCCATGTCGTTCTAGTTCAGGG + Intergenic
966564601 3:181362359-181362381 TTCCATGTGGTCCTCCCTCCAGG - Intergenic
973240455 4:47950848-47950870 TCCCTTTTGGTCCTACTTTTAGG - Intronic
974874401 4:67685627-67685649 TCCCATTAGGTCCTACGTAACGG - Intronic
987143857 5:14972133-14972155 TCCCAGGTGTTTCTCCTTCAAGG + Intergenic
988410258 5:30877355-30877377 TCCCAGGTGCTTCTACCTCAGGG + Intergenic
990755346 5:59063102-59063124 TCCCAGGTGGTTGTACTCCATGG - Intronic
993875060 5:93296782-93296804 TCTCATGTGTTCCTTTTTCAGGG - Intergenic
996047596 5:118892757-118892779 TTCCATCTGATCCTACTTCTAGG + Intronic
998063238 5:139135550-139135572 TCCCATGTTGTCTTCCTTCCAGG - Intronic
1002198474 5:177513684-177513706 TACCATCTTCTCCTACTTCAAGG - Exonic
1008893727 6:56527040-56527062 CCACATGTGATCATACTTCAAGG + Intronic
1017316331 6:153035786-153035808 CCCCATATGCTCCTCCTTCAGGG - Intronic
1019138429 6:169927219-169927241 TCCCATGTGGGCCTCTTTCTTGG + Intergenic
1020806995 7:12802340-12802362 TCCCATGTCCTCCTGCTTCCTGG + Intergenic
1021654303 7:22859863-22859885 TCCCATTTTGTCTTACTCCATGG + Intergenic
1022957614 7:35395987-35396009 TCACATGTCCTCCGACTTCAGGG - Intergenic
1024052711 7:45638972-45638994 TCCCATGTGGTCCTACTTCATGG - Intronic
1024211379 7:47208718-47208740 TCCCATGTTGTCCACCTTGAGGG + Intergenic
1024418245 7:49133335-49133357 TCACATGCGTTCCTGCTTCAAGG - Intergenic
1030385232 7:108860026-108860048 TCTCATTTGATCCTGCTTCAGGG + Intergenic
1034957003 7:155341002-155341024 CCCCATGTGGTCCATCTGCATGG - Intergenic
1038012758 8:23487755-23487777 GCCCATGTGGGCCTGCTTCAAGG + Intergenic
1039982502 8:42419614-42419636 TCACATGGAGTTCTACTTCAAGG + Intronic
1041456074 8:58061736-58061758 TCCCATGTGCTCCTTCTCCCAGG + Intronic
1042254152 8:66786295-66786317 ACCCAGGTGGTCTGACTTCAGGG - Intronic
1044190059 8:89305147-89305169 TCCCATATGTTCATTCTTCACGG - Intergenic
1045400573 8:101812660-101812682 TCCCAAGTGGACAGACTTCATGG - Intronic
1053272919 9:36762589-36762611 TCTCAGGTGGTCCTACTCCAGGG - Intergenic
1055924230 9:81493480-81493502 CTCCACGTGTTCCTACTTCATGG + Intergenic
1059310617 9:113386653-113386675 ACCCATGTAGTCCAACTCCAAGG - Exonic
1060475118 9:123980986-123981008 TTCCATGTGGTGCTACTCCAAGG + Intergenic
1060724142 9:125996148-125996170 ACCCATGGGGTCCTGCCTCAAGG - Intergenic
1186001008 X:5010500-5010522 TCCCTTCTGCTCCTCCTTCATGG - Intergenic
1188442149 X:30223259-30223281 TCCCATCAGGTCCTACTCAAGGG + Intergenic
1193764811 X:85514388-85514410 TCCCAGATGGTCCCACTTAATGG + Intergenic
1195446789 X:104961278-104961300 ACAAATGTGATCCTACTTCAAGG - Intronic
1197046684 X:122005969-122005991 TCCCAAGTGGTATTACTTGAGGG + Intergenic
1197725739 X:129775271-129775293 TCCCCTCTGGGCCTGCTTCAAGG + Intergenic
1201618226 Y:15925502-15925524 TCACATGTCTTCATACTTCAAGG + Intergenic