ID: 1024056387

View in Genome Browser
Species Human (GRCh38)
Location 7:45662233-45662255
Sequence CCTGCCATGCTGGAGCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 5, 3: 29, 4: 378}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024056378_1024056387 27 Left 1024056378 7:45662183-45662205 CCAATGTCATGACCTGCGAGGAC 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1024056387 7:45662233-45662255 CCTGCCATGCTGGAGCTGCCAGG 0: 1
1: 0
2: 5
3: 29
4: 378
1024056380_1024056387 15 Left 1024056380 7:45662195-45662217 CCTGCGAGGACGATGACAAGGTA 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1024056387 7:45662233-45662255 CCTGCCATGCTGGAGCTGCCAGG 0: 1
1: 0
2: 5
3: 29
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024056387 Original CRISPR CCTGCCATGCTGGAGCTGCC AGG Intronic
900083205 1:874577-874599 CCTGCAAGGCTGAAGCTGTCTGG + Intergenic
900464497 1:2818451-2818473 CCTGCCCTGCAGGGGCTGCAGGG + Intergenic
900641841 1:3691309-3691331 CCTGCCCTGCCCCAGCTGCCAGG + Intronic
900660119 1:3777966-3777988 CCTCCCCTGCTGGGGCTGGCAGG - Intergenic
901754831 1:11435147-11435169 CCTGCCAGGCTGCAGCGGGCAGG - Intergenic
902192744 1:14774980-14775002 CCTGCCCTCATGGAGCTCCCAGG + Intronic
902389349 1:16093859-16093881 CCTGACAACCTGGAGCTGCCTGG + Intergenic
902876164 1:19342180-19342202 GATGCTCTGCTGGAGCTGCCTGG - Intronic
902903090 1:19533778-19533800 CCTGCCTTGCTGGTGAGGCCTGG - Intergenic
903003432 1:20282631-20282653 CCTGCCATCAGTGAGCTGCCTGG + Intergenic
903998926 1:27326852-27326874 GCTGCCTTCCTGGAGCTTCCAGG + Intronic
905561358 1:38929670-38929692 GCTGCCCAGCTGGGGCTGCCAGG + Intronic
906197398 1:43937383-43937405 CCTCCCATCCCGGAGCTGCTGGG - Intergenic
909060291 1:70871336-70871358 CAAGCCATGATGGATCTGCCTGG + Intronic
909163488 1:72185090-72185112 CCTGCCATGTTCCAGGTGCCAGG - Intronic
910349430 1:86278358-86278380 CATGCCATGCAGCAGCTGCCAGG + Intergenic
911188318 1:94925739-94925761 CCTGACATGCTTGGGCTCCCGGG + Intronic
912179954 1:107207894-107207916 GCTGCCATGCTGTGGCTGCTAGG - Intronic
912708259 1:111930825-111930847 CGTGACATGCTGGAAATGCCAGG + Intronic
912797871 1:112703792-112703814 GCAGCCATGGTGGGGCTGCCAGG + Exonic
912978278 1:114348877-114348899 CCAACCATTCTGAAGCTGCCCGG + Intergenic
913176403 1:116276828-116276850 AGTCCCATGCTGGAGATGCCAGG + Intergenic
913247822 1:116885691-116885713 CCTGCCCTCCAGGAGCTTCCAGG - Intergenic
913323018 1:117603097-117603119 ACTGGCATCCTGGAGCTGGCAGG - Intergenic
915015405 1:152728321-152728343 CCTGACATGCTGGTTCAGCCAGG - Intergenic
915077352 1:153320122-153320144 CCTGGAATGCTGGAGCTTGCTGG - Intergenic
918154606 1:181832676-181832698 CCCGCCATGCCGGAGCCCCCCGG + Intergenic
918244539 1:182647231-182647253 CCTGCCATGGTGAAGGTCCCTGG - Intronic
919682852 1:200453485-200453507 ACTGCCATGCTGGAGCAGCCTGG + Intergenic
920337444 1:205254670-205254692 CCTTCCATTAGGGAGCTGCCAGG + Intronic
920561533 1:206942270-206942292 GCTTCCATGTTGGAGCTGACTGG - Intronic
921145631 1:212353228-212353250 GGTGCCATGCTGGAGAAGCCTGG - Intronic
922725745 1:227922253-227922275 CCTCCCATTGTGGAGATGCCAGG - Intronic
922795408 1:228337240-228337262 CCAGCCAAGCTGCAGGTGCCCGG + Exonic
923974419 1:239245408-239245430 TCACCCATGCTGGAGCTTCCTGG - Intergenic
924928913 1:248709850-248709872 CGTGCCATGCTGCAGCAACCTGG + Intergenic
1062860795 10:807657-807679 CCTGCCCTGGTGGAGCTGGAGGG - Exonic
1065880835 10:30036567-30036589 AGTGCCAGGCTGCAGCTGCCTGG - Intronic
1066350665 10:34634062-34634084 CCTGCCATTGTGTAGCTTCCTGG - Intronic
1067119130 10:43458989-43459011 CATGACTTGCTGGATCTGCCTGG + Intronic
1067450098 10:46376771-46376793 CCTGACATCCTGAGGCTGCCTGG - Intronic
1067587145 10:47482992-47483014 CCTGACATCCTGAGGCTGCCTGG + Intronic
1067634204 10:47990759-47990781 CCTGACATCCTGAGGCTGCCTGG + Intergenic
1067999435 10:51314334-51314356 CCTGAAATGCTGGAGTTGGCAGG + Intronic
1068762929 10:60733142-60733164 CCTGCCCTCCTGGGGGTGCCAGG - Intronic
1069842408 10:71348039-71348061 CCTGCCATGCTGAGGCAGCAGGG + Intronic
1070312981 10:75287239-75287261 CCTCCCATGCTGCAGCTCCCTGG + Intergenic
1073146652 10:101285773-101285795 GCTGCAAGGCTGGAGCTGCGAGG + Intergenic
1074553964 10:114471259-114471281 ACTGCCTTGATGGAGCTGCTGGG + Intronic
1074606073 10:114968632-114968654 TCTGCCTTGTTGGAGCTGCTAGG + Intronic
1075093283 10:119455142-119455164 CCTGCTCTGGTGGGGCTGCCAGG + Exonic
1075124710 10:119690433-119690455 CCTGCCATGGAGGTGCTACCAGG + Intergenic
1076500064 10:130930100-130930122 CCGCACCTGCTGGAGCTGCCGGG - Intergenic
1076519125 10:131068909-131068931 CCCGCCAAGCTGGAGATGACTGG - Intergenic
1077327480 11:1969988-1970010 CCTGCAGGGCTGGAGCTGCAGGG - Intronic
1077910777 11:6570079-6570101 GCTGCCATGCAAGAGCTGGCTGG + Exonic
1078450668 11:11438231-11438253 CCTGCCATCTGGGAGCTGACAGG - Intronic
1078543363 11:12228965-12228987 CCTGCCATCCTGGAGAGGGCAGG - Intronic
1080927851 11:36776942-36776964 ACTGCCATGCTTAAGCTGTCTGG - Intergenic
1082975032 11:59062879-59062901 GCTGCCATTCTGCAGCTGCGGGG - Intergenic
1083357197 11:62075576-62075598 CCTACAATGCTGGAGTGGCCTGG + Intergenic
1083993600 11:66261263-66261285 CCTGCCTTTCTGCAGCTCCCAGG - Intronic
1084118003 11:67053031-67053053 GCAGCCAGGCTGGAGCTGTCTGG + Intergenic
1084421103 11:69061036-69061058 CCTGCCGTGCTGCTGCTGGCTGG + Intronic
1085055013 11:73398326-73398348 GCGGCCATGCTGGGGCTGTCGGG + Intergenic
1085808309 11:79657272-79657294 AGCCCCATGCTGGAGCTGCCTGG + Intergenic
1086315633 11:85589055-85589077 CCTGCCCTGTTGGAGGTGGCAGG + Intronic
1086848703 11:91783279-91783301 CATCCAATGCTGGAGCTGCTGGG + Intergenic
1086886490 11:92211813-92211835 CCTGTCAGGCTGGAGCTGTGTGG + Intergenic
1088250745 11:107858988-107859010 CCTGCCACCCTGGAGGTGCCAGG - Exonic
1089296523 11:117472211-117472233 TCTCCCAAGCTGGAGCTGCATGG - Intronic
1089356626 11:117858151-117858173 CCATCCATGCTGGAGCATCCTGG + Intronic
1089781437 11:120875728-120875750 CCTGCAATGATGGAGCAGGCAGG - Intronic
1091294710 11:134465557-134465579 CATGGCATGCTGGATCTGCTGGG + Intergenic
1202810462 11_KI270721v1_random:25168-25190 CCTGCAGGGCTGGAGCTGCAGGG - Intergenic
1092313314 12:7382726-7382748 GGTGCCATGCTGGAGTTACCTGG - Intronic
1093469129 12:19482293-19482315 CCTGCTCTGCTGGAGGTGGCAGG + Intronic
1094014343 12:25846650-25846672 CCTGACTTTCTGGAGCTGTCAGG - Intergenic
1094491394 12:30963142-30963164 CTTGACAGGCTGGAGCCGCCTGG - Intronic
1094813693 12:34164516-34164538 CCTGCAAGGCTGAAGCTGTCTGG - Intergenic
1095363058 12:41367365-41367387 CCAGGCATGGTGGTGCTGCCTGG + Intronic
1095559794 12:43551707-43551729 CTGGCCCTGCTGGAGCTCCCGGG - Intronic
1095830955 12:46586056-46586078 CCTGCCTTGCTGCAGCTGGATGG - Intergenic
1096244308 12:49975704-49975726 CCTGCCTTGCAGGACCTGCCTGG + Exonic
1096750125 12:53753291-53753313 CCTGCCCTGCTGGAACTCCTAGG + Intergenic
1097821763 12:64134998-64135020 CCTCCCATGAGGCAGCTGCCAGG - Intronic
1098626249 12:72673433-72673455 CGTGACATGCTGAAACTGCCTGG - Intergenic
1101561986 12:105865294-105865316 CATGCCCTGCTTGAGCAGCCTGG - Intergenic
1101593896 12:106146341-106146363 CTTGCCATTCCGGAGCTTCCAGG - Intergenic
1101894964 12:108749448-108749470 CCTGAGATGCTGGAGCTCCGAGG + Intergenic
1102160571 12:110765345-110765367 CCTGCCATGTTGGAGTGGCCAGG - Intergenic
1102219637 12:111185855-111185877 CCTGCAATGTAGGAGCTGCTAGG + Intronic
1102529735 12:113537296-113537318 GCTGATATGCTGGAGCTGCCAGG - Intergenic
1103874138 12:124114317-124114339 TCTGCCAATCTGGAACTGCCTGG - Intronic
1103938078 12:124486936-124486958 CCGGCCATGCTGGCGTTGACTGG + Intronic
1104918251 12:132277622-132277644 CCAGCAGTCCTGGAGCTGCCAGG - Intronic
1104992795 12:132635487-132635509 CCTGCCATGCCCAAGTTGCCTGG + Intronic
1105605125 13:21920765-21920787 CCTGCCATGCCTGAGCCTCCCGG - Intergenic
1107431950 13:40348240-40348262 GCTGCATGGCTGGAGCTGCCAGG + Intergenic
1108941804 13:55964310-55964332 CCTGCCATCCTGGTGTTTCCTGG - Intergenic
1109075094 13:57824067-57824089 CCAGCCATGCTGCAGGTGGCAGG + Intergenic
1109536971 13:63734839-63734861 CCTGCCATACTGGAGCAACCTGG + Intergenic
1110760673 13:79227188-79227210 CCAGCCCAGCTGGTGCTGCCTGG + Intergenic
1112087048 13:96042128-96042150 CCTGCTCTGCTGGAGGTGGCAGG - Intronic
1112576706 13:100642720-100642742 GCTGCCATGATGGAGCTGCTGGG + Intronic
1113449778 13:110399759-110399781 CCTGCCCTGCAGGATCTTCCTGG + Intronic
1113930651 13:113967258-113967280 CCTCCCAGGCTGGCCCTGCCAGG + Intergenic
1114065053 14:19053462-19053484 TCTGCCCTGCTGCAGCTGCGGGG + Intergenic
1114097208 14:19346540-19346562 TCTGCCCTGCTGCAGCTGCGGGG - Intergenic
1115529395 14:34313116-34313138 CCTTCCATCTTGGAGCTGACTGG - Intronic
1116437607 14:44912333-44912355 CCTGCCGTGCTGGGGGAGCCGGG - Intergenic
1118027220 14:61781669-61781691 CATGCAAGGCTGGAGCTGTCAGG - Intronic
1118241290 14:64060977-64060999 CCTGCCATGCTGCTGCTGCTGGG + Intronic
1119480054 14:74953467-74953489 CCAGCCCTGGTGGAACTGCCGGG - Intronic
1120283035 14:82463545-82463567 CCTGCCTTGCTGGGGATCCCAGG - Intergenic
1121338768 14:93092829-93092851 CCTGCCGTGCTGGAGTCTCCTGG - Intronic
1122762271 14:104037989-104038011 GCTCCCATCCTGGAGGTGCCAGG - Intronic
1122772151 14:104102310-104102332 CCTGGCATGGTGGAGCTGAAGGG - Intronic
1122776024 14:104117267-104117289 CCTGCCCTGCTGCAGCCACCCGG - Intergenic
1122937459 14:104966714-104966736 CCAGCCCCTCTGGAGCTGCCTGG + Intronic
1123491571 15:20785696-20785718 GCTGCCCTGCTGCAGCTGCTGGG - Intergenic
1123548074 15:21354790-21354812 GCTGCCCTGCTGCAGCTGCTGGG - Intergenic
1124252714 15:28117465-28117487 CGTGCCAGGGTGGTGCTGCCGGG - Intronic
1129251795 15:74313207-74313229 CCTGGCATCCTGGAGCCACCAGG - Intronic
1129689048 15:77702908-77702930 CCTGCCCTCCAGGAGCTGCTGGG - Intronic
1202956405 15_KI270727v1_random:82020-82042 GCTGCCCTGCTGCAGCTGCTGGG - Intergenic
1132532267 16:458308-458330 GCAGCCCTGCTGGAGATGCCAGG - Intronic
1132655941 16:1041679-1041701 CCTTCCCTGCTGGAGCTCCCAGG - Intergenic
1132851028 16:2025151-2025173 CCTGGCAGGCTGTAGCTTCCTGG - Intergenic
1133774738 16:8887672-8887694 CCTGGCATGATGGGGCTGACAGG + Intergenic
1134378064 16:13697612-13697634 TCTGCCTTCCTGGAACTGCCAGG - Intergenic
1135133081 16:19868670-19868692 CTTGCCAACCTGGAGCTTCCTGG + Intronic
1136009349 16:27352832-27352854 CCTGCCGTGGTGTATCTGCCAGG + Intronic
1136566362 16:31073118-31073140 CCTGCCCTCCAGGGGCTGCCTGG - Intronic
1137760350 16:50935392-50935414 CCTGCCTTGCTTGTGCTTCCTGG + Intergenic
1137766646 16:50982553-50982575 CATGGCAGGCTGGAGCTTCCGGG - Intergenic
1139511544 16:67431001-67431023 CCTGCCCTGCGGGGGGTGCCGGG + Intronic
1140122946 16:72099109-72099131 GCTGCCCTTCTGGAGCTGCATGG + Intronic
1140538438 16:75732864-75732886 CTTGCCATGCAGGAAGTGCCTGG - Intronic
1141657717 16:85424978-85425000 CCTGCCCTGCTCCAGCTGCCTGG - Intergenic
1141863853 16:86736336-86736358 CCTGCCATCCTGGAGGGACCTGG + Intergenic
1142172057 16:88628055-88628077 TGTGCCCTGCTGGGGCTGCCCGG - Exonic
1142782489 17:2192080-2192102 TTTGCCATCCTGGAGCTGTCAGG - Intronic
1142855536 17:2727412-2727434 CCTGCCGAGATGGAGCTTCCAGG - Intergenic
1144193396 17:12867356-12867378 CCTGCCCTGCTAGAAATGCCAGG + Intronic
1144733238 17:17540608-17540630 CCTCTCATCCTGCAGCTGCCTGG - Intronic
1145058307 17:19717125-19717147 CCTTTCATGCTGGAGGGGCCTGG + Intronic
1145062514 17:19742055-19742077 CCTGTCACGCTGGAGCTGGGAGG - Exonic
1147320232 17:39641549-39641571 AGTGCTATGCTGGACCTGCCTGG + Intronic
1147608790 17:41789200-41789222 CCTGGACTGCTGCAGCTGCCAGG + Intergenic
1148317764 17:46718281-46718303 CCTGCCATACTGGCCATGCCGGG + Intronic
1149281274 17:55108258-55108280 CCTGGGATGCTGGAGCTTGCTGG - Intronic
1149645516 17:58238537-58238559 CCTGCCATTCTGCAGTTTCCTGG + Exonic
1149896632 17:60433399-60433421 CTAGCCATGCTGGAGCAGCTGGG + Intergenic
1151367332 17:73626112-73626134 CCTGCCAGGCTCCCGCTGCCTGG - Intronic
1151850461 17:76686852-76686874 CCTGCCTTGCTAGAGATGGCAGG + Intronic
1153473455 18:5471065-5471087 CCTGCCATGCAGGAGCAGAGTGG + Intronic
1153582534 18:6589039-6589061 CCTGGTATGCTGGAGTTGGCTGG - Intronic
1153625200 18:7016610-7016632 CCTGCCACGCTGCAGTTGCAGGG + Exonic
1154084808 18:11293366-11293388 CCAGCCTTGCTGGAGCTGGCAGG + Intergenic
1154449149 18:14460386-14460408 TCTGCCCTGCTGCAGCTGCGGGG - Intergenic
1157003867 18:43559250-43559272 CCTGCCATCCAGGTGCTTCCTGG + Intergenic
1157103080 18:44747477-44747499 CCTGCCATTCTCGAGCTGTGTGG - Intronic
1157815740 18:50728446-50728468 CCTGCCCTGGTGGATCTGCTTGG - Intronic
1158387573 18:57012582-57012604 GCAGCCCTGCTGTAGCTGCCTGG + Intronic
1158735534 18:60075191-60075213 GGTGCCATGCTGTAGCTGCTTGG - Intergenic
1160962527 19:1729911-1729933 TCTGCCATTATGGAGCTCCCGGG - Intergenic
1161053878 19:2180255-2180277 CCAGCCAGGCTGGAGCTCCCTGG + Intronic
1161210540 19:3063000-3063022 CCTGCCCTGGTGGTGGTGCCTGG + Exonic
1161454579 19:4363603-4363625 CCTCCCCTGCTGCAGCGGCCAGG + Intronic
1161511562 19:4675098-4675120 CCTGGGGTGCTGGGGCTGCCTGG - Intergenic
1161595753 19:5150309-5150331 CCTGCCATCCTGGCAGTGCCAGG + Intronic
1162044063 19:7987288-7987310 CCTGTCATGCCGGAGCCACCAGG - Intronic
1162319203 19:9960771-9960793 CCTGCCAGAATGCAGCTGCCTGG - Exonic
1162398937 19:10432970-10432992 CCTCTCATGCTGGAGCTGCCAGG + Intronic
1164623463 19:29711585-29711607 CCTGCCATGCTTGGTCTGCAAGG + Intronic
1164638014 19:29805637-29805659 CCTGCCCTCCAGGAGCTCCCAGG - Intergenic
1165885368 19:39074401-39074423 CCTGCCTTCCTGGAGCTGTTAGG + Intergenic
1167810843 19:51828883-51828905 CCTGCCCTCCAGGAGCTGCAGGG - Intergenic
1168170538 19:54585515-54585537 CCTGCGATGCTGCAGCTGGATGG - Intronic
925058331 2:872167-872189 CCTGCCATCCTGGCGGGGCCTGG - Intergenic
925348454 2:3186079-3186101 CCTGCCATCCACCAGCTGCCAGG + Intergenic
925439554 2:3872599-3872621 CCTGCCCTCCGGGAGCTGACAGG - Intergenic
925526512 2:4808894-4808916 CCAGCCCTGGTGGAGCTGACTGG - Intergenic
927111898 2:19869450-19869472 CCTGCCAGCCTGGAGGAGCCTGG - Intergenic
928204312 2:29273169-29273191 CTTGCCATTCTGGAGCTTCTGGG - Intronic
929815009 2:45223631-45223653 CCTGCCATGCTGTGGCGGCGGGG - Intergenic
930050424 2:47211483-47211505 ACTGCTGTGCTGGAGCTCCCTGG + Intergenic
930261430 2:49151246-49151268 TCTGCCATCCAGGAGCTGCAGGG + Intronic
930424423 2:51194607-51194629 CCTGCCTTGCTGGGGATCCCAGG + Intergenic
932363427 2:71129874-71129896 CCTGCCCTGCCTGACCTGCCGGG + Intronic
933465123 2:82641798-82641820 CCTGCCTTGCTGGAATTTCCAGG - Intergenic
933575660 2:84064072-84064094 CCTGCCATGATGGGGCTCCAGGG - Intergenic
934500568 2:94857563-94857585 CCTGCGATTCTGGGGCCGCCCGG - Intergenic
934624795 2:95836846-95836868 CCAAGGATGCTGGAGCTGCCTGG - Intergenic
934709472 2:96505486-96505508 ACTGACCTGCTGGAGCTGGCCGG + Intronic
935373331 2:102370161-102370183 CCTGCCATCCAGGAGCTCCAAGG - Intronic
936252290 2:110876216-110876238 CCTGCCACGCTGGAGTTGCCTGG - Intronic
936649865 2:114413724-114413746 CCTGCGATGCTGCAGCTGGATGG - Intergenic
937281020 2:120717190-120717212 CCTCCCATCCCAGAGCTGCCAGG - Intergenic
938482305 2:131672465-131672487 TCTGCCCTGCTGCAGCTGCGGGG + Intergenic
939628507 2:144508166-144508188 ACTGTGATGCTGGCGCTGCCCGG + Intronic
940739292 2:157488924-157488946 CCTGTAGTGCTGGAGCTGGCTGG + Intronic
942315550 2:174693570-174693592 GCTGCCTGGCTGGTGCTGCCTGG - Intergenic
943800009 2:192045766-192045788 CCTGCCACCCAGGAGCTGGCTGG - Intronic
945427931 2:209730260-209730282 GATGCCACGCTGGATCTGCCTGG - Exonic
946023758 2:216659513-216659535 CCTGCCCTTCTGGAGCTTGCTGG + Intronic
947543084 2:230991768-230991790 CCTGGCAGGGTGGAGCTGGCAGG - Intergenic
947815311 2:233032738-233032760 CCTGCCCTGCTCTACCTGCCTGG + Exonic
947933807 2:233985914-233985936 CATGCCAGGCTGGAGGTGCTGGG + Intronic
948398202 2:237663036-237663058 CCTGCCCTGCGGGAGCCGGCAGG + Intronic
948782203 2:240328805-240328827 CCTTCCATTCAGGGGCTGCCGGG - Intergenic
1168851723 20:981642-981664 TCTGCCATGCTGGGCCTGGCAGG - Intronic
1172617792 20:36300595-36300617 CCTGGCATGGAGGAGGTGCCTGG - Intergenic
1172701454 20:36855927-36855949 CCTGCCCTGCCGGAGAGGCCTGG - Intronic
1173854801 20:46243208-46243230 CCTGCCACGCAGGAGGAGCCGGG + Intronic
1174302829 20:49594694-49594716 CCTGTCACCCTGGAACTGCCAGG - Intergenic
1174883258 20:54303995-54304017 CTTGCCGTGCAGGAACTGCCTGG - Intergenic
1175270749 20:57732228-57732250 CCTGCCTTCCACGAGCTGCCTGG + Intergenic
1175777206 20:61660868-61660890 GCTGCCCAGGTGGAGCTGCCAGG - Intronic
1176310062 21:5144797-5144819 ACTGTCTTCCTGGAGCTGCCTGG + Intronic
1176447056 21:6830116-6830138 TCTGCCCTGCTGCAGCTGCGGGG + Intergenic
1176625388 21:9087710-9087732 CCTGCGATCCTGGGGCCGCCCGG + Intergenic
1176825227 21:13695142-13695164 TCTGCCCTGCTGCAGCTGCGGGG + Intergenic
1177320490 21:19513679-19513701 CCTGCCATCCAGAAGCTTCCTGG - Intergenic
1178764677 21:35439019-35439041 CTGGGCATGCTGTAGCTGCCTGG + Intronic
1178831556 21:36060789-36060811 CCTGCCAGGCTGGGTTTGCCGGG + Intronic
1178967320 21:37133657-37133679 CCTGCTCTGCTGGAGCTTTCAGG + Intronic
1179648030 21:42787172-42787194 CCAGCCCGGCTGGAGCTGGCTGG + Intergenic
1179846994 21:44117235-44117257 ACTGTCTTCCTGGAGCTGCCTGG - Intronic
1179880228 21:44290544-44290566 CCTGCCCTGCAGGAGCACCCGGG + Intronic
1179984510 21:44913212-44913234 CCAGCCTGGCTGGGGCTGCCAGG - Intronic
1179994835 21:44969203-44969225 GATGCCAGCCTGGAGCTGCCTGG - Intronic
1180039917 21:45270655-45270677 CCTGCTCTGCTGGAGGTGGCGGG - Intronic
1180108692 21:45637508-45637530 CCTCCCTAGCTGGAGCGGCCTGG + Intergenic
1180483543 22:15776082-15776104 TCTGCCCTGCTGCAGCTGCGGGG + Intergenic
1181032851 22:20156663-20156685 GTGGCCATGCTGGGGCTGCCAGG + Intergenic
1181291707 22:21799462-21799484 CCTGTCCTGCTGGAGCTCTCAGG + Intronic
1181510465 22:23386602-23386624 GTGGCCATGCTGGGGCTGCCAGG - Intergenic
1182044979 22:27267247-27267269 TCTACCTTGCTGGAGCGGCCGGG - Intergenic
1182475166 22:30573225-30573247 CCTGCCTTCTTGGATCTGCCTGG - Intronic
1182736266 22:32533746-32533768 CCTGCCAGGCTGGACCAGCCAGG + Intronic
1183204685 22:36410491-36410513 CCTGCCAAGCTCCAGGTGCCCGG + Intergenic
1183492607 22:38124674-38124696 TCTGCCCTGGTGGAGCTTCCAGG - Intronic
1183519185 22:38286618-38286640 CCTGCCATGCTCGTGGTCCCAGG + Intergenic
1184499995 22:44865726-44865748 CCTGCCATGCTGGGCCCGCATGG - Intergenic
1184726293 22:46348584-46348606 GCTGCCGTGCTGGCTCTGCCAGG - Intronic
949362086 3:3242904-3242926 CCTGCCATGTTGAACATGCCTGG + Intergenic
950334312 3:12181506-12181528 CCAGCCATGCTGAAGCAACCAGG + Intronic
950476439 3:13218071-13218093 CCTAGAATGCCGGAGCTGCCAGG - Intergenic
950488146 3:13285006-13285028 CCTGCCTTTCAGGAGCTTCCAGG + Intergenic
951017406 3:17745495-17745517 CCTGGCAGGCTGGTGCTGACTGG - Intronic
951971078 3:28444358-28444380 CCTCCCCTGATGCAGCTGCCAGG - Intronic
951996594 3:28736586-28736608 CCTGCCTTGCTGGGGATCCCAGG + Intergenic
952020184 3:29009525-29009547 CCTTCCATGCTAGATCTGCCTGG + Intergenic
952271211 3:31833458-31833480 CCTGACATGCAGAAGCTGCATGG + Intronic
953667293 3:44934450-44934472 CCTTCCATGGTGGAGGTACCTGG - Intronic
953703624 3:45215186-45215208 CCTGCCATGCATGAGCTGTTTGG - Intergenic
953849013 3:46450915-46450937 CCTGCCAGGCAGCAGCTGCACGG - Intronic
954415697 3:50392260-50392282 CCAGCTATGCTCGGGCTGCCAGG - Intronic
954416255 3:50394883-50394905 CCTGCCATGGTGGTTCTGCGAGG - Intronic
954429934 3:50465145-50465167 GGTGCCAGGCTGCAGCTGCCCGG + Intronic
954432635 3:50479327-50479349 CCTGGCATCCTGGACCTGCTGGG + Intronic
954798242 3:53172348-53172370 CCGGGCATGGTGGAGCTGCCAGG - Intronic
956247035 3:67195348-67195370 GCTGCGATGCTGGAGATGCAGGG - Intergenic
957040102 3:75329812-75329834 GCTGCTGGGCTGGAGCTGCCAGG + Intergenic
960034156 3:113086340-113086362 CCTGCCCTGTTGGAGATGCAGGG + Intergenic
961044889 3:123701355-123701377 GCTGCTGGGCTGGAGCTGCCGGG + Intronic
961429704 3:126872642-126872664 CCTTCCTTGCCTGAGCTGCCAGG + Intronic
962311911 3:134332675-134332697 TCTGCCCTGCTCCAGCTGCCTGG + Intergenic
962626427 3:137229988-137230010 CCTGCCAGGCTGGAGCTATCTGG + Intergenic
963040444 3:141066165-141066187 CCGGCCAAGCGGGAGCTGCGGGG + Exonic
966121607 3:176527933-176527955 CCTGCCCTGCTGAGGCTGTCTGG + Intergenic
968618953 4:1595075-1595097 CCTGGCATGCTGGCACTGGCTGG - Intergenic
968620787 4:1602677-1602699 CCCGCCAGGCAGGAGCTGCGAGG + Intergenic
968848362 4:3060720-3060742 GCCGCCATGTTGGATCTGCCTGG - Intergenic
968937943 4:3623274-3623296 CCTGGCATGCAGGAGTAGCCTGG - Intergenic
969532470 4:7737439-7737461 CCTGCCTTGATGGGGCTGTCGGG - Intronic
969627497 4:8315016-8315038 CCAGCAATTCTGGAGATGCCAGG - Intergenic
971392218 4:26196838-26196860 TCTGCCATGCTGGAGAGGCTTGG + Intronic
973771770 4:54213428-54213450 GCTGCGATGCTGGAGCTGCAGGG + Intronic
975153435 4:71045154-71045176 CCTGCCTTGCTGGAGATCCCAGG - Intergenic
976777585 4:88722965-88722987 CGTGTTATGCTGCAGCTGCCCGG - Intergenic
977771710 4:100868526-100868548 CCTGCTATGCTGCAGCTGGAAGG - Intronic
979576042 4:122293647-122293669 CCTGCCTTGCTGGAATTCCCAGG - Intronic
982780339 4:159483801-159483823 CCTGCCTTGCCTCAGCTGCCTGG + Intergenic
985619417 5:946199-946221 CCCGCCACCCTGGAGCTGTCCGG + Intergenic
985731444 5:1551524-1551546 CCTGCCGTGCTGGAGCTGGCTGG + Intergenic
986131046 5:4930515-4930537 CCTTCTTTGCTGGGGCTGCCAGG - Intergenic
986233313 5:5886035-5886057 CCAGCGATGCTGGGGCTACCGGG - Intergenic
986654726 5:9999792-9999814 CCTGCCATCCTGGTGTTCCCAGG - Intergenic
987999430 5:25330462-25330484 CCTGGCATTCAGGGGCTGCCTGG - Intergenic
989069054 5:37490993-37491015 CGTGCCATGCTGCAGGTGCTTGG + Intronic
989144143 5:38231899-38231921 CCAGCCAGGCTGAAGATGCCAGG + Intergenic
990961105 5:61394394-61394416 CTTCCCATGCTGGGGGTGCCAGG - Intronic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
997194761 5:131971549-131971571 CCTGGCACCCTAGAGCTGCCCGG + Exonic
998245976 5:140505740-140505762 CATGCCCTGCTGTTGCTGCCAGG - Exonic
998372945 5:141672805-141672827 ACGGGCATGCTGGAGCTGCGTGG - Exonic
998883703 5:146672059-146672081 CCTGCCAAGCTCCAGCAGCCTGG - Intronic
999189207 5:149733644-149733666 CCTGCCAAGCAGAAGCTCCCAGG + Intronic
1000343280 5:160294174-160294196 CCTGCCTTGCTGGGCCTCCCAGG - Intronic
1000743597 5:165001517-165001539 CCTGCCATCCAGGAGCTGATGGG - Intergenic
1001146766 5:169191845-169191867 CCTGACATGCTGCAGCAGCTGGG + Intronic
1002094543 5:176823304-176823326 CCTGGCAGGGTGGAGCTCCCTGG - Intronic
1002131458 5:177084476-177084498 CCTGCCTTGCTGGAGCTCCCAGG - Intergenic
1003072957 6:2959004-2959026 CCACCCATGCTGGAGCACCCTGG - Intronic
1004825099 6:19411415-19411437 CCTGCCATGCTGGGGTTGAAGGG + Intergenic
1005438568 6:25840381-25840403 CCTGCCAACCTGGATGTGCCTGG - Intronic
1005756790 6:28932287-28932309 CCTGCCCTTATGGAGCTGACAGG + Intergenic
1006219170 6:32473481-32473503 GCTGCCATGCGGGAGCCTCCAGG + Intergenic
1006716965 6:36126633-36126655 CCTGACATCTGGGAGCTGCCTGG + Intergenic
1006790931 6:36700800-36700822 CCTGCAAGGCTGGAACTGCCAGG + Intronic
1007072544 6:39048150-39048172 CCTGCAATGCTGAAGTTTCCAGG + Intergenic
1007878985 6:45140657-45140679 CCTGCTGTGCTGGAGGTGGCAGG - Intronic
1008848691 6:55997762-55997784 CATGCCATGCAGCTGCTGCCAGG + Intergenic
1008892758 6:56513828-56513850 CCAGTCATGCTGGAGCTATCTGG + Intronic
1009813919 6:68706279-68706301 CCAGCAATGATGGAGCTGGCTGG + Intronic
1010812405 6:80315162-80315184 CCTGCCTTGCTGGGGATCCCGGG + Intronic
1012092581 6:94918226-94918248 CTTACCATGATGGAGCTGCAGGG - Intergenic
1013166801 6:107601577-107601599 CCTGCCCTGCTGGACCAGCCAGG - Intronic
1013819174 6:114134729-114134751 CCTTCTATGCTGGGACTGCCAGG + Intronic
1014658136 6:124132711-124132733 CCTGCCCTGGTGGAGGTGGCTGG - Intronic
1015142865 6:129955396-129955418 CCTGCCATGTGGGATCCGCCTGG + Intergenic
1015897966 6:138035167-138035189 CATGCCATGCTCCACCTGCCCGG + Intergenic
1016567357 6:145471573-145471595 CACACCATGCTGCAGCTGCCTGG - Intergenic
1017032780 6:150238654-150238676 CCTGCCTTCCAGGAGCTCCCAGG - Intronic
1017526062 6:155242202-155242224 CCTCACAGGCTGGTGCTGCCTGG - Intronic
1018621515 6:165733415-165733437 GCTGCCACGCTTGAGCTGCCCGG + Intronic
1018927290 6:168215214-168215236 CCTGCCCTGCACGAGCCGCCTGG + Intergenic
1019292609 7:257924-257946 CCTGGGGTGCTGGAGATGCCCGG + Intronic
1019306747 7:339084-339106 CCTGCCGTGCTAGAGCTGCTGGG - Intergenic
1020100412 7:5391189-5391211 TCTCCCAGGCAGGAGCTGCCAGG + Intronic
1021531129 7:21646641-21646663 CTTGCCCTGCTGGAGCTCACTGG - Intronic
1021843467 7:24742093-24742115 CCTGCTCTCCTGGAGGTGCCTGG - Intronic
1022106047 7:27199009-27199031 CCAGCCATGCTCGGGCTCCCAGG + Intronic
1022989715 7:35695265-35695287 CCCGCCGTGCTCGGGCTGCCCGG + Intronic
1023051752 7:36258673-36258695 CCTGGGATGCTGGAGCTGGTGGG - Intronic
1023173621 7:37413971-37413993 CTTGCCATGCTGAAGTGGCCTGG - Intronic
1023994050 7:45148070-45148092 CCTGTCAAGATGGAGCTGCAGGG - Intergenic
1024056387 7:45662233-45662255 CCTGCCATGCTGGAGCTGCCAGG + Intronic
1026222394 7:68411858-68411880 GCCGCCATGTTGGACCTGCCTGG - Intergenic
1028764729 7:94540584-94540606 CCTGTGATGCTGCAGCTGACGGG + Intronic
1029230256 7:99061170-99061192 GCCACCATGCTGGAGCTTCCTGG + Intronic
1029510560 7:100992172-100992194 CCTGGCATGGTGGTACTGCCAGG - Exonic
1029511043 7:100995337-100995359 CCTGGCATGGTGGTACTGCCAGG - Exonic
1029511765 7:101000008-101000030 CCTGGCATGGTGGTACTGCCAGG - Exonic
1029523185 7:101077480-101077502 CCTGCCCTTCTCCAGCTGCCTGG + Intergenic
1030605386 7:111633875-111633897 GGTGTCATGCTGCAGCTGCCTGG + Intergenic
1031031622 7:116741526-116741548 CCTGCCATGCTGGGGCACACAGG + Intronic
1034279595 7:149843801-149843823 CCTCCCATGCTGGAGGTTTCCGG + Intronic
1034566858 7:151922227-151922249 CCTGGAATTCTGGACCTGCCTGG + Intergenic
1034875384 7:154720593-154720615 CCTGCCATGCTGCAGCCGGGGGG - Intronic
1034969921 7:155412625-155412647 CATCCCATGCAGGAGGTGCCTGG + Intergenic
1035115375 7:156519074-156519096 CCAGCCCTGCTGCACCTGCCTGG + Intergenic
1035663801 8:1365502-1365524 CCTGCCATCCTGGACCTGGGAGG - Intergenic
1037075527 8:14712272-14712294 CCTTGCAGGCTGGCGCTGCCTGG + Intronic
1037579911 8:20238968-20238990 GCTGCCATGCTGGAGCAGGGGGG - Intergenic
1041220736 8:55648632-55648654 CCTGCCATTCAGGTGCTTCCTGG + Intergenic
1041381418 8:57257951-57257973 CCTGCCCTCCTGCAGCTGCAGGG - Intergenic
1042497050 8:69466826-69466848 GCTGCCTTGCTGGAGCTGTGTGG + Exonic
1043600233 8:81928698-81928720 CCCTCCATGCTGGTGCTGGCTGG - Intergenic
1044889061 8:96813105-96813127 CCTGCCATGCTGAAGCTTTTGGG - Intronic
1046233341 8:111387368-111387390 GCTGCCCTGCTGGAGCTGTGTGG - Intergenic
1046249520 8:111611842-111611864 CCTGCTTTGCTGCAGCAGCCAGG - Intergenic
1047423420 8:124726188-124726210 CCTGCCATCCTGTGGCTGCGTGG - Intronic
1047961553 8:130015596-130015618 CTTACCATGCTGGAGCTACTTGG - Intronic
1048924053 8:139254810-139254832 CCTTCCATGTTGGAGTTGCCTGG - Intergenic
1049492214 8:142911473-142911495 CAGGGCATGCTCGAGCTGCCTGG + Exonic
1049525916 8:143126939-143126961 CCTACCCCTCTGGAGCTGCCAGG - Intergenic
1049690754 8:143957837-143957859 CCTGCCCTGCTGGGGCTCTCTGG + Intronic
1049799456 8:144511009-144511031 CTGGCCACGCTGGAGCTGCTGGG + Exonic
1049820801 8:144632043-144632065 CCTGCCCTCCTGGGTCTGCCAGG + Intergenic
1050250419 9:3737765-3737787 CCTGCCATCCTGGAGTAGGCAGG - Intergenic
1053149230 9:35732299-35732321 CCTGCCAGGGAGGGGCTGCCGGG - Exonic
1053656602 9:40222985-40223007 CCTGCGATCCTGGGGCTGCCCGG + Intergenic
1053906956 9:42852207-42852229 CCTGCGATCCTGGGGCCGCCCGG + Intergenic
1054357022 9:64071432-64071454 CCTGCGATCCTGGGGCCGCCCGG + Intergenic
1054368707 9:64369207-64369229 CCTGCGATCCTGGGGCCGCCCGG + Intergenic
1054453225 9:65414433-65414455 CCTGGCATGCAGGAGTAGCCTGG + Intergenic
1054528012 9:66153300-66153322 CCTGCGATCCTGGGGCCGCCCGG - Intergenic
1054676334 9:67858959-67858981 CCTGCGATCCTGGGGCCGCCCGG + Intergenic
1056514196 9:87334480-87334502 CTTGACATGCTGGGGCTCCCAGG + Intergenic
1056678843 9:88699382-88699404 CCAGCTATGCTGGGGCTGCTGGG + Intergenic
1057866837 9:98687995-98688017 CCTGGCAGGCTGGAGCCCCCAGG - Intronic
1057907163 9:98992204-98992226 CCTGCCATGCCCGAGCCCCCTGG - Intronic
1058923399 9:109639795-109639817 CCTGCCCTGCAGGAGCTCACGGG - Intergenic
1059391284 9:114001117-114001139 CCTGCCAGGCTGGATCTGAGGGG + Intronic
1059510036 9:114836420-114836442 CCTGCCTTGCTGGGGATCCCAGG + Intergenic
1061673758 9:132203857-132203879 GCTGCCTTCCTGGAGCTTCCTGG - Intronic
1061801853 9:133117066-133117088 AGTGCCATGCTGAAGGTGCCAGG + Intronic
1061974692 9:134062243-134062265 CCTGCTCTCCTGCAGCTGCCTGG + Intronic
1062091672 9:134681626-134681648 GGTGCCATGCTGGGGCTGCAAGG - Intronic
1062383742 9:136299988-136300010 CCTGCCCTGCAGGGCCTGCCTGG + Intronic
1062401033 9:136372725-136372747 CCAGCCCTGCTGCAGCTGCGGGG + Intronic
1203522134 Un_GL000213v1:54415-54437 TCTGCCCTGCTGCAGCTGCGGGG - Intergenic
1203748561 Un_GL000218v1:58171-58193 CCTGCGATCCTGGGGCCGCCCGG + Intergenic
1188513085 X:30957809-30957831 GCAGGCATGCTGGAACTGCCTGG - Intronic
1189148779 X:38683570-38683592 TCTGCCCTGCTGGACCTGCCTGG - Intronic
1192451892 X:71249949-71249971 CCTCCCATCCTGGGGCTGCAGGG - Intronic
1192567137 X:72174342-72174364 CCTGCGGTGCTGGACCTTCCAGG - Intergenic
1193108303 X:77703380-77703402 CGTGCCCTGCTGCAGCTGCCAGG - Intronic
1193108671 X:77705345-77705367 CCTTCCAAGTTGGAGCTCCCTGG - Intronic
1194358779 X:92920612-92920634 CATACCATGCTGAAGCTGCAGGG + Intergenic
1194577020 X:95625641-95625663 CGGGCCATGGTGGAGATGCCAGG + Intergenic
1194910798 X:99642019-99642041 CCTGCTCTGCAGGAGCTGGCTGG - Intergenic
1197023238 X:121716532-121716554 CCTGCCTTGCTGCAGATCCCAGG + Intergenic
1198770266 X:140123404-140123426 CCTGCTATGGTGGAGGTGGCAGG + Intergenic
1199489957 X:148387311-148387333 GGTGCCATGCTGGAGCTTCTTGG - Intergenic
1200053877 X:153448692-153448714 CCTGCCATCCTGGTGGTGCCTGG - Intronic
1200666945 Y:6036306-6036328 CATACCATGCTGAAGCTGCAGGG + Intergenic
1201758789 Y:17516575-17516597 CCTGCAAGGCTGAAGCTGTCTGG - Intergenic
1201842766 Y:18389415-18389437 CCTGCAAGGCTGAAGCTGTCTGG + Intergenic