ID: 1024058916

View in Genome Browser
Species Human (GRCh38)
Location 7:45683832-45683854
Sequence AGTTACCTGCAAAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024058914_1024058916 3 Left 1024058914 7:45683806-45683828 CCAAGAGGCTTTCTCAAAAGGAG 0: 1
1: 0
2: 1
3: 21
4: 206
Right 1024058916 7:45683832-45683854 AGTTACCTGCAAAAGATGGCAGG No data
1024058911_1024058916 15 Left 1024058911 7:45683794-45683816 CCCAGCGGCAGGCCAAGAGGCTT 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1024058916 7:45683832-45683854 AGTTACCTGCAAAAGATGGCAGG No data
1024058912_1024058916 14 Left 1024058912 7:45683795-45683817 CCAGCGGCAGGCCAAGAGGCTTT 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1024058916 7:45683832-45683854 AGTTACCTGCAAAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024058916 Original CRISPR AGTTACCTGCAAAAGATGGC AGG Intronic
No off target data available for this crispr