ID: 1024062032

View in Genome Browser
Species Human (GRCh38)
Location 7:45704985-45705007
Sequence CTGTGGAAAAGGAGAGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 404}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024062032_1024062035 16 Left 1024062032 7:45704985-45705007 CCTTGCACTCTCCTTTTCCACAG 0: 1
1: 0
2: 5
3: 32
4: 404
Right 1024062035 7:45705024-45705046 TACAAATAATTATTCTGAATAGG 0: 1
1: 0
2: 6
3: 67
4: 527

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024062032 Original CRISPR CTGTGGAAAAGGAGAGTGCA AGG (reversed) Intronic
900087815 1:906828-906850 CTGTGGCTAAGGAGAATGCCCGG - Intergenic
900146142 1:1159608-1159630 CTGTGGACATGGAGAGTGGCGGG - Intergenic
900469444 1:2846085-2846107 CTGGAGAAAAGGGAAGTGCAGGG - Intergenic
900620157 1:3583076-3583098 TTGGGGAAAGGGAGGGTGCAAGG + Intronic
900655150 1:3753148-3753170 ATCTTGAAAAGGAGAGTGAAGGG + Intronic
900737590 1:4308903-4308925 CTATGGGAAGGGAGAGGGCAGGG - Intergenic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903202184 1:21750419-21750441 CTGTGGAGAAGAAGAAAGCAGGG - Intronic
904482645 1:30803830-30803852 CTTTGGAAATGGACAGTGCTGGG - Intergenic
904918548 1:33987755-33987777 GTCTGGAATAGGTGAGTGCATGG - Intronic
905259486 1:36707339-36707361 CTGGGGAGAAGGAACGTGCAAGG - Intergenic
907183391 1:52590251-52590273 TTTTGGAATAGGGGAGTGCAGGG + Intergenic
908157442 1:61368648-61368670 CTGTGTAAAAGTATCGTGCAGGG + Intronic
909883118 1:80905187-80905209 CAGTGGATAAAGAGAGTGGAAGG + Intergenic
914756307 1:150563339-150563361 CTGGGGACAAGGGGAGAGCAAGG - Intergenic
914817262 1:151071980-151072002 CTTTGGAAAAGGACAGTCTATGG + Intronic
915082960 1:153364724-153364746 ATGTGGAAAATGAGAGGCCAGGG + Intergenic
915684431 1:157617213-157617235 CTGTAGCAAAGGAGTGAGCAGGG + Intergenic
915839892 1:159205298-159205320 CAGTGGAAAAGGACAAAGCAGGG - Exonic
916527960 1:165629805-165629827 CGGTGTAAAATGAGGGTGCAAGG + Intergenic
916758130 1:167792529-167792551 CTATGCAAGAGGAAAGTGCAGGG - Intergenic
917048132 1:170886407-170886429 CTGTATAAAAGCAGAGTGGAGGG + Intergenic
917177013 1:172246613-172246635 GTGTGGAAAATGAAAATGCATGG + Intronic
917405041 1:174696686-174696708 CTTGGGAAAGGGAGAGAGCAGGG - Intronic
917495991 1:175540691-175540713 CTGGGGAAGGGGAGAGTGGATGG - Intronic
917510269 1:175663813-175663835 CTGGGGAACTGGAGAGTCCAAGG + Intronic
917719979 1:177778085-177778107 CTGTGGAAGAGGAATGTGTATGG - Intergenic
917834870 1:178933559-178933581 ACGTGGAAGAGGAGAGTCCATGG + Intergenic
918072396 1:181142478-181142500 CTTTGGTAAACAAGAGTGCAGGG - Intergenic
919779921 1:201215176-201215198 CTGTGGGACAGGACAGGGCAGGG - Intronic
920308754 1:205035685-205035707 CTGTGGATCTGGAGAGTGAATGG + Intergenic
921248775 1:213276798-213276820 CACTGGAAAAGGAGAGTTGAAGG + Intergenic
921251880 1:213305806-213305828 AGGTGGAAATGGAGAGGGCACGG - Intergenic
922133252 1:222799762-222799784 CTGAGTAAAAGGAGAGTAGATGG - Intergenic
922207342 1:223459979-223460001 CTGGGGAAGAGGAAACTGCAAGG - Intergenic
922256968 1:223900800-223900822 CTGAAGAAAAGGACAGTGAATGG + Intergenic
923826884 1:237510122-237510144 ATGTGGAAAAGCAGAGAGCCTGG + Intronic
924338163 1:243003613-243003635 CTGGAGAAAAGGACAGTGAATGG + Intergenic
924662696 1:246036376-246036398 CTCTGGAGAAGGAGACTGCGGGG - Intronic
924929029 1:248711278-248711300 TTGTGGAGAAGGTGAGTGCTAGG - Intergenic
1063141085 10:3257175-3257197 CTTTGCAAAAAGAGAGTGTATGG - Intergenic
1063545054 10:6972804-6972826 CTGTGTAAAAGGATAGAGAAAGG - Intergenic
1064151890 10:12872259-12872281 GTGTGAAAAAGGAGAGGGCCTGG + Intergenic
1064642133 10:17425932-17425954 CTGTGGAAAAAGAGTGGGGATGG - Intronic
1068005402 10:51387403-51387425 CAGTGGAAAATGAAAATGCAGGG - Intronic
1068769292 10:60803158-60803180 CAGTGCAAAATGAAAGTGCAGGG + Intergenic
1072044125 10:91637671-91637693 GTGAGGAAAAGGAGAGGGGAGGG + Intergenic
1072474819 10:95750209-95750231 CTGTGGGAAAGGAGCGGGGATGG + Intronic
1072625314 10:97107619-97107641 TTTTGGAAAAGGAAATTGCAAGG + Intronic
1073275019 10:102302250-102302272 CTGTGGAAAGGGAGAGGGAAAGG + Intronic
1073284356 10:102378596-102378618 CTGTGCAAAACTGGAGTGCATGG - Intronic
1073955307 10:108864070-108864092 TAGTGGAAATGGAGAATGCATGG - Intergenic
1074121002 10:110494550-110494572 CAGTGGGAAAGGAAAATGCAGGG + Intergenic
1074174113 10:110978662-110978684 ATGTGGGAGAGGAGACTGCAAGG - Intronic
1076157981 10:128218125-128218147 CCGTGGAAAAGTGGGGTGCAGGG - Intergenic
1076175664 10:128366143-128366165 CCTTGGTAAAGGAGAGGGCAGGG - Intergenic
1076734308 10:132451930-132451952 CTGTGGAAGAGCAGGGTGCTGGG + Intergenic
1077394395 11:2313964-2313986 CAGTGCAAAACGAGAGGGCAGGG + Intronic
1078063755 11:8064577-8064599 TTGTGGAAAAGGAGACTGTTAGG + Intronic
1078634367 11:13035120-13035142 ATTTGGAAAAGGAGAGGGGATGG + Intergenic
1078821888 11:14891462-14891484 CTGTGAGAATGGAGAATGCAGGG - Intronic
1079175089 11:18132747-18132769 CTGTGGAAGAAGAGAGTTCTTGG - Intronic
1080391213 11:31848415-31848437 TTGTGCAAAAGGAGAAAGCAAGG - Intronic
1081628133 11:44667658-44667680 CTGTGGAGCAGGAGAGTGCGTGG - Intergenic
1082206111 11:49436051-49436073 CTGTGGAAACGGAGATAACATGG + Intergenic
1084147371 11:67272240-67272262 CTGTGGAAGAGCTGGGTGCAGGG - Intronic
1084150500 11:67285885-67285907 CTGTGGAGCAGGACAGTGCAGGG - Exonic
1084777433 11:71386908-71386930 CTTTGGAACAGGACACTGCAAGG - Intergenic
1085304318 11:75476609-75476631 CTGAGGCAAAGGAGAGGGAAGGG - Intronic
1085504760 11:77051639-77051661 CTGTGGGAATGGAGCATGCAGGG + Intergenic
1086855440 11:91860106-91860128 ATGTGGAAGAGGAAAGTGGAGGG - Intergenic
1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG + Intergenic
1090358135 11:126154327-126154349 CAGGGGAAGAGGAGATTGCAGGG + Intergenic
1090867327 11:130713268-130713290 CGGTGGGACAGGAGAGGGCATGG - Exonic
1091002746 11:131924115-131924137 GTGTGGAAATGCACAGTGCAGGG + Intronic
1091555344 12:1569306-1569328 CTGGTGAAAAGGAGAGGGAATGG - Intronic
1091591965 12:1847677-1847699 CTGTGTAAAAGCAGAGAGAATGG + Intronic
1092272182 12:7031769-7031791 CAGTGGGAAAGGTGAGTCCAGGG - Intronic
1092283900 12:7117667-7117689 CTGTTGAAAAGGAGAGCAGATGG + Intergenic
1092404076 12:8204551-8204573 CTGTGAGAAAAGAGAGTGAAGGG - Intergenic
1093452757 12:19334476-19334498 TTGTGGAAATGCAGAGTTCAGGG - Intronic
1095696146 12:45146434-45146456 CTGTAGAAAGGGAGAGTGATAGG + Intergenic
1095972945 12:47916818-47916840 CTGTGGAAAGGGAAAGAGCATGG + Intronic
1097927240 12:65142485-65142507 CTCTGGAAACGGAAAGGGCAAGG + Intergenic
1098092178 12:66915447-66915469 CTTTAGAAAAGAAGAGTGTATGG + Intergenic
1098316948 12:69202787-69202809 CTATGGAACAGGAGACTGGAGGG + Intergenic
1098724324 12:73943807-73943829 CAGTGGGAAAGGAGATTTCAAGG - Intergenic
1099454567 12:82848250-82848272 CTCTGGGACAGGAGAGAGCATGG - Intronic
1099783605 12:87232452-87232474 CTTTGGAAAAGGTGAGTACCTGG + Intergenic
1101201043 12:102436602-102436624 TTGTGGCAAAGGAGGGTGGAAGG + Intronic
1102139887 12:110605882-110605904 CGGTGGAGGAGGAGAGAGCAGGG + Intergenic
1102741607 12:115212281-115212303 CAGAGGTAAAAGAGAGTGCATGG - Intergenic
1102784348 12:115592043-115592065 CTGTGTAGAAGGAGAGTTAAGGG - Intergenic
1103245057 12:119449720-119449742 GTGTGGGAAGGGAGAGTGCATGG + Intronic
1104958647 12:132477831-132477853 CTGTGGGGCAGGAGAGTGCTGGG - Intergenic
1106898973 13:34334921-34334943 CTGAGGAAGAGGAGAGTGCAGGG + Intergenic
1107650281 13:42538051-42538073 CTGTGGGAAAGGGGAGGCCAGGG - Intergenic
1107853885 13:44595942-44595964 CTGAGGACAAGGAGAGTGGCAGG + Intergenic
1108673029 13:52710975-52710997 CTATGGAAAATGCCAGTGCAGGG - Intronic
1108959884 13:56213489-56213511 CTGAGAAAAAGGAGAGTTGATGG - Intergenic
1111731300 13:92080206-92080228 CTGTGGAGAACGATGGTGCAGGG - Intronic
1112620672 13:101050926-101050948 CAGTAGAAAAGGGGAGTCCATGG - Intergenic
1113041724 13:106110559-106110581 GAGTGGAAAAGCAGAGTTCAGGG - Intergenic
1113062464 13:106338027-106338049 CTCTGGAAAAGTAGATTGAAGGG - Intergenic
1113536345 13:111069348-111069370 CTGTGGGAGGGGAGAGTGTAAGG + Intergenic
1114297222 14:21340822-21340844 TAGTGGAATAGGAGAATGCATGG - Intronic
1114733218 14:25016806-25016828 ATGTAGAAAAGGAGATGGCATGG + Intronic
1116352603 14:43884790-43884812 CTATGGTAAAGGTAAGTGCAAGG - Intergenic
1117667637 14:58073619-58073641 CTGTCTAAAAGTAGATTGCAAGG - Intronic
1118731607 14:68670692-68670714 CAGTGGAAGATGAGAGTGGATGG - Intronic
1119605717 14:76014655-76014677 CTGAGGAGAAGGAGAGGTCAAGG - Intronic
1120174112 14:81275477-81275499 CCGTGTCAAAGGAGAGTTCAGGG + Intronic
1120602311 14:86526631-86526653 CTGTGAAAAAGGAAAGCTCAAGG - Intergenic
1121299644 14:92860358-92860380 CGGCGGAAAAGGAGAGGGGAAGG + Intergenic
1121463069 14:94096936-94096958 CCATGGGAAAGGAGAGTGGATGG + Exonic
1121522845 14:94598258-94598280 CTGTGGAGATGGAGAGTGGGTGG + Intronic
1121529066 14:94640013-94640035 CTGTGGAAAGGGCGAGAGCAAGG + Intergenic
1121876968 14:97461903-97461925 CCGTGGTAAGGCAGAGTGCATGG - Intergenic
1121952559 14:98184343-98184365 TTGTCTAAAAGGTGAGTGCAGGG + Intergenic
1124094548 15:26636960-26636982 CCGTGGGAGAGAAGAGTGCAAGG - Intronic
1124292153 15:28463139-28463161 CAGTGGAAAAGGAGAGAACTTGG + Intergenic
1124365412 15:29067671-29067693 TTGTGGAAAAGGCGAGAGGATGG - Intronic
1124483471 15:30097375-30097397 CTGTGGACCAGGCGAGGGCACGG + Intergenic
1124489922 15:30149437-30149459 CTGTGGACCAGGCGAGGGCACGG + Intergenic
1124520107 15:30399851-30399873 CTGTGGACCAGGCGAGGGCACGG - Intergenic
1124538548 15:30566373-30566395 CTGTGGACCAGGCGAGGGCACGG + Intergenic
1124753610 15:32388890-32388912 CTGTGGACCAGGCGAGGGCACGG - Intergenic
1124760103 15:32441209-32441231 CTGTGGACCAGGCGAGGGCACGG - Intergenic
1124825490 15:33090528-33090550 CTGAGAAAAATGAGAGTCCAGGG + Intronic
1124969581 15:34473190-34473212 CTGTGGCAAGGCAGAGTGGAAGG + Intergenic
1124975351 15:34524592-34524614 CTGTGGACCAGGCGAGGGCACGG - Intergenic
1125977190 15:43965051-43965073 GTATGGAAAAGGATAGAGCATGG + Intronic
1127540963 15:59938638-59938660 CTGTAGAAAAGTAGAGGGAAGGG - Intergenic
1128645737 15:69377654-69377676 CTGTGTAAAATGAGAGGGCTTGG - Intronic
1129044495 15:72721815-72721837 CTTTGGAAAAGGAGAAAGCAAGG - Intronic
1129168631 15:73794238-73794260 CTGTGGAAAGGGAGTGGTCATGG + Intergenic
1129190188 15:73932889-73932911 CTGTGGAAACGGAGGGTTCTGGG + Intronic
1129378642 15:75151681-75151703 CAGTGTAAAACGAAAGTGCAAGG - Intergenic
1130044131 15:80430957-80430979 ATCTGGGGAAGGAGAGTGCATGG - Intronic
1131593536 15:93773808-93773830 CTGAGGATAAGGAAAGTGTAGGG - Intergenic
1131845302 15:96484850-96484872 CTGACAAAAAGGAGAGTGCTGGG - Intergenic
1132185003 15:99796674-99796696 CTGTGGACCAGGTGAGGGCACGG + Intergenic
1132431985 15:101767880-101767902 CTGTGGACCAGGTGAGGGCACGG - Intergenic
1132826471 16:1907900-1907922 CTGTGGAGAGGGTGGGTGCAGGG + Intergenic
1134774113 16:16837085-16837107 CTGGGGGAAAGGAGAGGGGAGGG + Intergenic
1135277092 16:21122609-21122631 TTTGGGAAAGGGAGAGTGCATGG - Intronic
1135748469 16:25037290-25037312 CTGTAGAAAGGGAGAGTGAGTGG - Intergenic
1136068538 16:27774772-27774794 CTGGGGAAACGGGGAGTGCCGGG - Intronic
1136165012 16:28447970-28447992 CTGTGGAAAGTGAGAGAGGAAGG - Intergenic
1136214300 16:28781187-28781209 CTGTGGAAAGTGAGAGAGGAAGG + Intergenic
1136234574 16:28905792-28905814 GTGGGGAAAGGGAGAGGGCATGG - Intronic
1136500077 16:30665617-30665639 CTCTGGGAAAGGGGAGTGGAGGG - Exonic
1137521616 16:49199929-49199951 ATGTGGGAAAAGAGAGTCCAGGG - Intergenic
1138272575 16:55706348-55706370 CTATGGAAAAGGAGATTGGAAGG + Intergenic
1138379844 16:56592180-56592202 GTTTAGAAAAGGAGAATGCAAGG + Intergenic
1138532055 16:57639828-57639850 CTGGGGAGAAGGGGAATGCACGG - Intronic
1139301508 16:65948910-65948932 CTGGGGCCAAGGTGAGTGCATGG + Intergenic
1140514732 16:75533712-75533734 CTGTGTAAAAGGAGAGAGAAAGG + Intronic
1140712647 16:77692824-77692846 AGGTGGAAAAGGGGAGTGAAGGG - Intergenic
1141435280 16:83996361-83996383 CAGTGCAAAATGAGCGTGCAAGG + Intronic
1143188478 17:5024313-5024335 CTGAGGAAAGGAAGAGGGCACGG + Exonic
1143818632 17:9541293-9541315 ATGTGGAAGAGGAGAATGGAGGG + Intronic
1144173709 17:12684505-12684527 CTGTGCAAAATGACAGTGCAGGG + Intronic
1144667744 17:17113135-17113157 CAGTGGAAGAAGAGACTGCAGGG - Intronic
1144812608 17:18010233-18010255 CTGTGGCAGAGGAGAATGCAGGG + Intronic
1144937875 17:18914690-18914712 CTTTGGCAAAAGAGGGTGCATGG - Intronic
1146156683 17:30530285-30530307 CTGTGGAAAGGAAGAGTGCGTGG - Intergenic
1147669223 17:42167161-42167183 GTGTGGAAAGTGAGAGTCCAGGG - Intronic
1148106733 17:45122864-45122886 CTGGGTAAACGGAGAGTCCATGG + Intronic
1148289475 17:46431591-46431613 CTGTGGAGGAGGAGAGTGCAGGG + Intergenic
1148311644 17:46649163-46649185 CTGTGGAGGAGGAGAGTGCAGGG + Intronic
1148791487 17:50175689-50175711 CTGTGGGAAGAGAGAGTGGAGGG - Intronic
1149988459 17:61366587-61366609 CTCTGGAAAATGGGGGTGCACGG - Intronic
1150010683 17:61499964-61499986 CAGTGGAAAAGGATGGTGCTGGG + Intergenic
1150054739 17:62003826-62003848 GTGTAGAAAAGTAGCGTGCAGGG - Intronic
1150198070 17:63321912-63321934 CTGTGGAAGAGAAGGGTGAAGGG - Intronic
1150422378 17:65049692-65049714 CTGGGGAAAGGGAGGGGGCATGG + Intronic
1150530972 17:65981142-65981164 ATGTAGAGATGGAGAGTGCAAGG - Intronic
1152231419 17:79115749-79115771 CTGTGGAAGGAGAGAGAGCAAGG + Intronic
1152720220 17:81919958-81919980 GTGTGGAAGAGGAGGGTGTAAGG - Exonic
1157174735 18:45441112-45441134 AAGTGGAAAAAGAGAGGGCATGG - Intronic
1158009564 18:52713284-52713306 CTGTGCAAAACAAGACTGCAGGG + Intronic
1158906054 18:62012910-62012932 CTGTGGTTATGGAGAGAGCAGGG - Intergenic
1160066056 18:75575364-75575386 CTGGGGCCAAGGAGAGTGAAGGG - Intergenic
1161412106 19:4122818-4122840 CTGTGGGAAAAGACAGGGCATGG - Intronic
1161525132 19:4749763-4749785 CTGTAGAAAAGGACAGGACACGG + Intergenic
1161639990 19:5416181-5416203 CTGTGGAAAAAGAGTGTGGCAGG - Intergenic
1161750055 19:6089345-6089367 CTCTGAAAAGGGAGTGTGCACGG + Intronic
1163186790 19:15644489-15644511 ATGTTTGAAAGGAGAGTGCAGGG + Intronic
1163218018 19:15895054-15895076 ATGTTTGAAAGGAGAGTGCAGGG - Intronic
1163889315 19:19996920-19996942 ATGTGGAGAAGGAGAGCACAGGG - Intergenic
1165008412 19:32824804-32824826 CTTTGGAAAAGCAGAGGCCATGG + Intronic
1165390340 19:35534941-35534963 CTGAGGAAAGGGAGACAGCAGGG - Intronic
1165661755 19:37586957-37586979 CTGTGGAAGAGGAGATGCCATGG - Intronic
1165793539 19:38506086-38506108 ATCTGGGAAAGGAGAGGGCAGGG + Intronic
1166080540 19:40441586-40441608 CGGTAGAAAAGGAGCCTGCACGG - Exonic
1166161218 19:40954874-40954896 CTGTGGATAAGTAGTGTGCTTGG + Intergenic
1167429420 19:49446097-49446119 CTGTGAAGAAGGAAAGTGCAGGG + Intergenic
1167742153 19:51330147-51330169 GTGGAGAAAAGGAGAGGGCAAGG + Exonic
1168060274 19:53888027-53888049 CTGTTAAAAAGGAGACAGCACGG - Intronic
925070496 2:963647-963669 CTGTGGAAAAGAAAAATGAAAGG - Intronic
926724091 2:15984046-15984068 TTGTGTAACAGGAGAGTGAAAGG - Intergenic
926885042 2:17589421-17589443 CTGTGCAGAAGGAGAGTGGTTGG + Intronic
927466138 2:23338101-23338123 GTGTGGAGAGGGAGAGTGGATGG + Intergenic
928092753 2:28385853-28385875 CTGTGTAACAGGAAAGTCCAGGG + Intergenic
928376669 2:30780385-30780407 CTGTAGAAATGCAGAATGCAAGG + Intronic
930489364 2:52048680-52048702 CTGAGGAAAAGAAGAGAGAAAGG + Intergenic
930718782 2:54618780-54618802 CTTTGGGAAAGGGGAGTGTAGGG + Intronic
931067831 2:58606790-58606812 CTGTGGAAAAGCAGAGGGGAAGG + Intergenic
933472448 2:82743066-82743088 CTGGAGAAATGGAGAGTTCAAGG - Intergenic
934298628 2:91763157-91763179 AAGTGGAGAAGGAGAGTGAAAGG - Intergenic
934602118 2:95665676-95665698 CTGTCGAAAAAGAGATTGAAGGG - Intergenic
934636201 2:95992047-95992069 CTGTGGAAGAGAAGAGCGCGCGG - Intergenic
934775131 2:96932464-96932486 CTCAGGAAAAGCTGAGTGCATGG - Intronic
934797448 2:97113379-97113401 CTGTGGAAGAGAAGAGCGCGCGG + Intergenic
934835963 2:97590060-97590082 CTGTGGAAGAGAAGAGCGCGCGG - Intergenic
934898306 2:98138096-98138118 ATGTGGAAGAGGAAAGTGGATGG - Intronic
935127782 2:100239508-100239530 CTGTGGTACAGGGGAGTTCAGGG + Intergenic
935327307 2:101948547-101948569 CTGTGGAGGTGGAGAGTGGATGG + Intergenic
936465442 2:112744636-112744658 CTGTGGGAGAGAAGAGAGCAGGG - Intronic
936703515 2:115041657-115041679 GTGTGGAAAAACAGAGTGAATGG - Intronic
936996568 2:118420789-118420811 CTGTGGAAGAGGGAAGAGCATGG + Intergenic
937220884 2:120342838-120342860 CTGTGGAAAGGGAGAGAATATGG - Intergenic
937413685 2:121697699-121697721 CTGTGGACAGGGAGAGGGCAGGG + Intergenic
937712750 2:124996700-124996722 CTGTAGATAATGAGAGTTCAGGG + Intergenic
938118183 2:128616216-128616238 CGGTGGAACAGGAGAGCGAAGGG - Intergenic
938173073 2:129099977-129099999 CTATGGAAAAGGAAAGCACAAGG - Intergenic
939469140 2:142597516-142597538 TTGTGGAAGAGGTGAGTGCGGGG + Intergenic
939866775 2:147481746-147481768 CAGGGGAAAAGGGGAGTTCAGGG + Intergenic
939955974 2:148527957-148527979 CTGTGGATCAGGAAAGAGCAGGG - Intergenic
940348431 2:152652646-152652668 TTGTGGAATAGGACAGTGCCTGG - Exonic
941343698 2:164339909-164339931 ATGTGGAAAAGGAAAATGAAGGG + Intergenic
942205449 2:173615752-173615774 ATGAGGAAATGGAGAGTGCCGGG - Intergenic
942209741 2:173658540-173658562 CTGTGAAACAGCAGACTGCATGG + Intergenic
942518539 2:176778936-176778958 ATGTGGAAAATGAGAATGTAAGG - Intergenic
942735615 2:179108467-179108489 CTGTGTAAAACCAGACTGCAAGG + Exonic
944041326 2:195358177-195358199 CAGTGTAAAAGGAGAGTCCAAGG + Intergenic
944082144 2:195799877-195799899 CTGTGGAAAAGAAGAAGGAAAGG + Intronic
944287683 2:197970243-197970265 GTGTGTAAAAAGAGAGAGCATGG + Intronic
944655514 2:201873296-201873318 CTGTTGAAAATAAGAGTGGAGGG - Intronic
946065667 2:216985363-216985385 CTCTGGAAGAGGAGAGGGCCTGG - Intergenic
946089215 2:217206048-217206070 ATATGGAAAAGGAGTGTCCAGGG + Intergenic
946507766 2:220319560-220319582 CTGTGGGAGAGGAGTTTGCAAGG - Intergenic
947576481 2:231279017-231279039 CTGTGGCAACAGAGAGTGGATGG - Intronic
947757832 2:232581052-232581074 GAGTGCAAAAGGAGAGCGCACGG - Intronic
948650797 2:239442421-239442443 CTGTGCACAGGGAGAGTGCCAGG + Intergenic
1169274459 20:4224312-4224334 CTTTGAAAAAGGAGAGTGCCAGG + Intronic
1170293793 20:14801783-14801805 CTATGAAAAAGGAAAGTGAAAGG + Intronic
1170602280 20:17849914-17849936 CTGAGGAAAATGTGAGTGTATGG - Intergenic
1172050927 20:32117386-32117408 TTATGGGAAAGGAGATTGCAAGG + Intronic
1172489829 20:35327134-35327156 CTGTGGAGAAGAAGAAGGCAGGG - Intronic
1172845880 20:37929789-37929811 ATGTGGGAAGGGAGAGTGGAGGG + Intronic
1175376131 20:58525195-58525217 GGGTGGAAAAGGCGAGTGTATGG - Intergenic
1175391660 20:58631453-58631475 CTGGGGACAAGGGGAGTGGAGGG - Intergenic
1175923565 20:62461341-62461363 CTGGTGGGAAGGAGAGTGCAGGG + Intergenic
1176074777 20:63243469-63243491 CTGTGGAGAAGGATAGAGCCGGG - Intronic
1176169334 20:63689924-63689946 ATGTGGGGAAGGAGAGTCCAGGG - Intronic
1176312815 21:5162629-5162651 CTGTGGTAATGGAGAGTTCTGGG - Intergenic
1178895909 21:36556672-36556694 CTGTGGACACGGAGAATTCACGG - Intronic
1179077842 21:38140786-38140808 CTGTGCAAAATGAAAATGCAAGG + Intronic
1179844233 21:44099401-44099423 CTGTGGTAATGGAGAGTTCTGGG + Intronic
1181296418 22:21843411-21843433 CTGTCAGAGAGGAGAGTGCAGGG + Intronic
1181962189 22:26630187-26630209 CTGTGGTAGGGGAGAGAGCATGG + Intronic
1182118199 22:27769973-27769995 ATGAGGAAAAGGAGAGTCGATGG + Intronic
1182599265 22:31447566-31447588 CTGCTGAAAAGGAGAGGGGAGGG + Intronic
1183236439 22:36622298-36622320 TTGTGGAAATGCAGACTGCAGGG + Intronic
1183411859 22:37659458-37659480 GTGGGGAACAGGAGAGTGCGAGG + Intronic
1184306535 22:43606874-43606896 ATGTGGGAAATGAGAGTGGACGG - Intronic
1185363767 22:50425153-50425175 CTGTGGAGAGGGAGAATGAATGG - Intronic
951521278 3:23612611-23612633 CTGTGAAAAAGGAGAGAGAGGGG + Intergenic
952777204 3:37058160-37058182 ATGTGGAAAAGGACAGTGCCAGG + Intronic
954303164 3:49711921-49711943 GTGTGGAAAAGTGGAGTACAAGG - Intronic
954569379 3:51627767-51627789 CTGTGTAAGAGGAGAGGGAAAGG + Intronic
955977187 3:64490239-64490261 CTGTGGGAAAGGAGGATGCCTGG - Intergenic
956935513 3:74096469-74096491 CTGGGGAAAAGGAAAATGTAAGG - Intergenic
957050480 3:75407904-75407926 ATGTGGAAAAGCAGAGGACAGGG + Intergenic
957627469 3:82672112-82672134 CTGAGGATCAGGAGAGTGCCTGG - Intergenic
957903353 3:86526391-86526413 GTGTGGAAGAGGAGAGTTCTTGG + Intergenic
958918235 3:100073465-100073487 CTGGGGTAGAGGAGATTGCAGGG + Intronic
959572332 3:107898167-107898189 CTGTGAAAAAACAGAATGCAAGG + Intergenic
960010035 3:112823767-112823789 CAATGGAAGAAGAGAGTGCAGGG + Intronic
960441731 3:117697180-117697202 CTTCGGGAAAAGAGAGTGCATGG + Intergenic
961311797 3:126007081-126007103 CAGTGAAAAAGCAGAGTGCCAGG + Intronic
961732670 3:128978005-128978027 TTGTGGACAAGCTGAGTGCAAGG - Intronic
961756488 3:129130189-129130211 CTGTGGAAATTAAGAGTGCAGGG + Intronic
962951104 3:140219683-140219705 CTGTGGAATTGGAGACAGCAGGG + Intronic
962962182 3:140321238-140321260 CTATGGATATGGAGAGTCCAGGG - Intronic
963449042 3:145454145-145454167 CAGTGTACAAGAAGAGTGCAGGG + Intergenic
964310057 3:155382972-155382994 CCGTGGAAAAGGAGGGAGCCAGG - Intronic
965403228 3:168238570-168238592 ATGTGGAACAGGAGAATCCATGG + Intergenic
965820032 3:172676051-172676073 CTGCTGAAAAGGAGCATGCAGGG - Intronic
965910485 3:173769181-173769203 CTGTGGAAAAGATGAGTGTAAGG - Intronic
966780893 3:183583453-183583475 TTGTGGATCAGGAGACTGCAGGG + Intergenic
967214397 3:187198307-187198329 CTGTGCAAAAGGAGAAAGCCAGG - Intronic
967283778 3:187849320-187849342 CTTTGTAAAATGAGATTGCAGGG - Intergenic
967859330 3:194139837-194139859 CTGTGGGAAAGGCCAGAGCAGGG - Intergenic
968229319 3:196996055-196996077 CTGGGGAAGAGGAAAGAGCAGGG - Intronic
968234690 3:197024564-197024586 CTGTGGGAGAGGTGTGTGCACGG + Intronic
969204040 4:5629030-5629052 AGGTGGAAAGGGAGCGTGCATGG - Intronic
969523715 4:7693525-7693547 ATGGGGCAAAGGACAGTGCAGGG - Intronic
970307495 4:14748769-14748791 CTGTGGAAAAGGAAAAGACAAGG - Intergenic
970937457 4:21590362-21590384 CTGGGGAAAAATAGATTGCAGGG + Intronic
971041855 4:22762704-22762726 CTATGAAAAAGGAGAGTGTCAGG - Intergenic
971606238 4:28661528-28661550 GTGTGGAAAGAGAGAGTGCAGGG - Intergenic
972017074 4:34261290-34261312 TTGTGGAATAGGTGAGTGCTGGG - Intergenic
973050542 4:45590515-45590537 CTTTGGAAAAGCAGAGAACAAGG + Intergenic
973163668 4:47050844-47050866 ATATGGAAAAAGAGAGTGGAAGG - Intronic
973907635 4:55546956-55546978 CTGGGGAAAGGGAGAGTGAGGGG - Intronic
976369149 4:84267059-84267081 CTGTGGCAGGGGAGATTGCATGG + Intergenic
976762890 4:88569275-88569297 CTTGGGGAAAGGAGAGTGCCGGG - Intronic
977186992 4:93951292-93951314 ATTTGGAGAAGGAGAGTTCAGGG - Intergenic
977853368 4:101857611-101857633 CTGTGGAAAAGAGCAGTGCTAGG - Intronic
979238960 4:118431675-118431697 CTGGAGAAAAGGACAGTGAATGG - Intergenic
981582148 4:146260766-146260788 CTGTGAAAAGGGAGAGGGCCTGG + Intronic
981641363 4:146946984-146947006 CTGTGAGAAAGGAAGGTGCATGG - Intergenic
983927319 4:173416057-173416079 CTGCGGGAGAGGAGACTGCACGG - Intergenic
985491974 5:185636-185658 CTGTGGAAGAGGAGGCTGCTGGG + Exonic
985542277 5:492550-492572 CTGGGAACGAGGAGAGTGCAGGG + Intronic
986144663 5:5066077-5066099 CCGTGGCAAAGGGGAGGGCAAGG + Intergenic
987094032 5:14532562-14532584 CTGTGGAAAAGAAAAGCCCACGG - Intergenic
987692284 5:21282687-21282709 CCGTGGAACAGGAGACTGGAGGG - Intergenic
988382248 5:30512816-30512838 ACTTGGAAAAGGAGACTGCAGGG + Intergenic
988512354 5:31875913-31875935 CTGTGAAAAAGGAGTATGAAAGG - Intronic
988949088 5:36240574-36240596 TTTAGGAAAAGGAGAGTGCCCGG - Intronic
989507690 5:42246364-42246386 TTGTGGGATAGGAGAGTCCACGG - Intergenic
989665265 5:43846550-43846572 AAGTGGAAAAGCAAAGTGCAAGG + Intergenic
990596956 5:57321796-57321818 CAGTGGAAAAGGAGGTTCCAGGG - Intergenic
992325896 5:75659371-75659393 CTGTTGACAAGGTAAGTGCATGG + Exonic
992766458 5:80005509-80005531 CTTTGTAAAAAGAGTGTGCACGG + Intronic
993746634 5:91606914-91606936 CTGTGAAAAAAGGGAGTGAAAGG + Intergenic
994620116 5:102153213-102153235 CTGTGTAAAAGCAGAATCCACGG + Intergenic
995736173 5:115302182-115302204 CTGTGGAAAATGAGCAAGCAGGG - Intergenic
996642659 5:125776128-125776150 CTCTGGAAAAGGAGGAGGCAAGG - Intergenic
996873301 5:128215619-128215641 CTATGGAAAAGGAGACAGCAGGG + Intergenic
997428800 5:133823395-133823417 CTGGAGAGGAGGAGAGTGCAGGG - Intergenic
998045834 5:138985902-138985924 CTGTGGAGCTGGAGATTGCAGGG - Intronic
998046668 5:138992487-138992509 CTGTGGAAAAGGAGCCTGCTAGG - Intronic
998471927 5:142390271-142390293 CTGGGGAGAGGGAGAGTGCAGGG + Intergenic
999118441 5:149186075-149186097 CTCTGGAGAGGGAGAGAGCAAGG + Intronic
999194916 5:149775236-149775258 CTGTGGATCTGGAGAGGGCAGGG + Intronic
999322252 5:150622779-150622801 CTGTGGAGCAGGGGAGTGGAGGG - Intronic
999737096 5:154521127-154521149 CTGGGGAAAAGGAGAATTCCAGG + Intergenic
999769930 5:154767835-154767857 GTTTGGAAATGGTGAGTGCAAGG + Intronic
1000802155 5:165740934-165740956 CAGTGGAAAAGAAAAGTGGATGG + Intergenic
1003004312 6:2366970-2366992 CTGTGGAAAAGCAGGGGGCAGGG - Intergenic
1004069339 6:12283847-12283869 CTGTGGCAAAGGACAGCACATGG - Intergenic
1005425864 6:25701876-25701898 TGGTGGAGAAGGAGAGTGAAGGG + Intergenic
1005822307 6:29607997-29608019 CAGAGGAAAAAGAGAGAGCAAGG + Intronic
1006487772 6:34358173-34358195 CTCTGAAAAAGAAGAGTGAAGGG - Intronic
1006665769 6:35691973-35691995 CAGTGAAAAATGAGAGTGCAGGG - Intronic
1007219651 6:40268494-40268516 CAGTGTGAAAGGAGAGGGCAGGG + Intergenic
1008339076 6:50343192-50343214 GTGTGGGAAAGCAGACTGCAGGG + Intergenic
1013635380 6:112024439-112024461 CTGAGGCAAAGGAGGATGCAGGG - Intergenic
1013639628 6:112060507-112060529 GTGTGGAAGAGCAGAGTGGAAGG + Intronic
1013865543 6:114691760-114691782 CTGTGGAAAAGAGGGCTGCAGGG - Intergenic
1014298498 6:119650754-119650776 ATGTGGAAAAGAAGAATGTAAGG - Intergenic
1014820393 6:125982791-125982813 CTGAGGAAAAGGAGGATGGATGG - Intergenic
1015189839 6:130460626-130460648 AGGAGGCAAAGGAGAGTGCATGG - Intergenic
1015238176 6:130994384-130994406 CTGTGCAACAGGAGAGGGCAGGG + Intronic
1015356874 6:132287669-132287691 CAGTGTAAAATGAGAGTCCATGG - Intergenic
1015863397 6:137703425-137703447 CTATGGAAAAACAGACTGCAGGG - Intergenic
1016088233 6:139942610-139942632 ATGAGGAAAAGGAGAGTCCTCGG - Intergenic
1016192134 6:141282539-141282561 CTGTGTAAAAGGAGATGGGATGG - Intergenic
1016322607 6:142862127-142862149 CAGTGTAAAAAGAGAATGCAGGG - Intronic
1016683954 6:146860695-146860717 CTGTGGAAAAAGAGAATGCATGG - Intergenic
1017014226 6:150087168-150087190 CTGGGGAAGAGGGGAGGGCATGG + Intergenic
1018005070 6:159614069-159614091 CAGTGGAACAAGTGAGTGCATGG - Intergenic
1019184052 6:170210609-170210631 TGGTGGGAAAGGAGAGTGAAGGG + Intergenic
1022055848 7:26733634-26733656 TTGTGGAGAAGGGGAGAGCAGGG + Intronic
1023272741 7:38482884-38482906 TTGTGGGGAAGGAGAGTCCAGGG - Intronic
1024062032 7:45704985-45705007 CTGTGGAAAAGGAGAGTGCAAGG - Intronic
1024667993 7:51564954-51564976 CTGAAGAAACGGAGAGTACAGGG - Intergenic
1024672537 7:51609183-51609205 CAGTGCAAAATGAGAGTGCAAGG + Intergenic
1027354314 7:77341285-77341307 CTGTAGAAAAGGAGGATTCAAGG - Intronic
1028311978 7:89349932-89349954 CTGTGCAACAGGACAGTGCTAGG - Intergenic
1028471558 7:91211921-91211943 TTCTGGAACGGGAGAGTGCATGG + Intergenic
1030187729 7:106779972-106779994 CTGTGGGAAAAGAGGGAGCATGG - Intergenic
1031068509 7:117135095-117135117 CAGTGGGGAAGGAGAGTGAAAGG + Intronic
1031329787 7:120450450-120450472 GAGTGGAAAAGGAGAGGGGATGG + Intronic
1031541022 7:122994574-122994596 CAGTGGAAAAGGATAGAGAAAGG + Intergenic
1033112502 7:138593702-138593724 CTAAGGAAAAGGAGAGAGAAGGG + Intergenic
1033172441 7:139095956-139095978 CTGAGAAAAAGGAGAGTAGATGG + Intronic
1034526784 7:151669136-151669158 CTGGGGAAAGAGTGAGTGCAGGG - Intronic
1035781189 8:2229411-2229433 CTGTGGGGAAGGAGGCTGCAAGG - Intergenic
1036220110 8:6914383-6914405 CAGAGGAGAAGGTGAGTGCAAGG - Intergenic
1036397882 8:8384305-8384327 CTGTGCAAAGGGAGTGTGGAAGG + Intronic
1037836883 8:22219871-22219893 GTGTGGAGAAGGAGAGAACATGG - Exonic
1039386245 8:37138174-37138196 TTGGGGGAAAGGAGGGTGCAGGG + Intergenic
1039911191 8:41828368-41828390 AGGTGGAAAATGAGAGTTCATGG - Intronic
1043027667 8:75091242-75091264 CTATGGAAAAGGAGAAGACAGGG - Intergenic
1044065870 8:87699643-87699665 GGGTGGAAAAGGGGAGTGGATGG - Intergenic
1045566576 8:103322556-103322578 ATGTGGAAAAGGTCAGTGAATGG - Intronic
1046276110 8:111962431-111962453 CTGTGGTAAAAGAGTGTGCTTGG + Intergenic
1047005314 8:120614084-120614106 CTGTGGATAAACAGTGTGCATGG - Intronic
1047795112 8:128247305-128247327 CACTGGAAAAGGAGAGTGGGGGG + Intergenic
1047907191 8:129484740-129484762 CTGGGGAAAAGGGAAGGGCAGGG - Intergenic
1048157618 8:131974371-131974393 CTGTGGTAAAGAGAAGTGCAGGG + Intronic
1048288916 8:133164714-133164736 CTGTGGAGAAGGACAGTGAATGG - Intergenic
1049247746 8:141571769-141571791 GTGTGGGAAAGGATAGTGGAAGG - Intergenic
1049412370 8:142478959-142478981 CTGTGGAGAAGCAGAGTGTGGGG + Intronic
1049761756 8:144334794-144334816 CGGAGGAGAAGCAGAGTGCATGG - Intronic
1050747393 9:8892173-8892195 CTGAGGAAAAGCAGCGTGGATGG - Intronic
1051185896 9:14461024-14461046 CTGAGGAACAAGAGGGTGCACGG - Intergenic
1051190756 9:14509608-14509630 TTGGAGAAAAGGAGAGGGCAAGG - Intergenic
1054754409 9:68942913-68942935 CTGTGGAAAGGCAGTGGGCATGG + Intronic
1055150933 9:72998746-72998768 CTGTGGAGAAAGAGGGTGTATGG - Intronic
1055494113 9:76837562-76837584 ATGTGGAAAAGGATAGAGCAGGG + Intronic
1055910963 9:81350641-81350663 CTTTGGGGAGGGAGAGTGCAGGG + Intergenic
1057912507 9:99031100-99031122 CTGTGGCAAAGGAGCCAGCAGGG - Intronic
1058263860 9:102873291-102873313 CAGAGGTAAAGGAGAGAGCAAGG + Intergenic
1058670643 9:107358053-107358075 CAGTGCAAAATGAAAGTGCAAGG + Intergenic
1059323710 9:113488820-113488842 GAGAGGAAAAGGAGAGCGCAAGG - Intronic
1059880678 9:118685615-118685637 CTGAGGAAACAGAGAGGGCATGG + Intergenic
1060786873 9:126458051-126458073 CCGTGGTGAGGGAGAGTGCAGGG - Intronic
1061207602 9:129173891-129173913 CTGTGGTAAAGGAGAGTGGATGG - Intergenic
1061784316 9:133017005-133017027 CTGTGGAAAGGGAGAGAGATGGG - Intergenic
1061786231 9:133030315-133030337 ATGTGGAAAAGGCGAGCGCGGGG - Intergenic
1062356861 9:136169201-136169223 CTGTGGCCAAGGAGGGGGCAAGG + Intergenic
1185570271 X:1128990-1129012 CTGTGGAGAAGGCGAAGGCATGG - Intergenic
1185643286 X:1600053-1600075 CTGAGGACAAGGAGCGTGCCGGG - Intronic
1186342913 X:8662344-8662366 CGGTGAAAAATGAGAATGCAAGG - Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187082674 X:16007511-16007533 CTGTGGGACAGGAGAGTGTGGGG + Intergenic
1188965394 X:36545352-36545374 CTGGGGAAAATGAAAGTGTAGGG - Intergenic
1189528906 X:41857815-41857837 CTGTGGACAAGGAGATTGTCAGG + Intronic
1189557088 X:42156040-42156062 CAGTGGAAAAGGGGAGTGTAAGG + Intergenic
1189634520 X:42991677-42991699 ATGTGCACAAGGAGAATGCATGG + Intergenic
1189758441 X:44296212-44296234 ATGTGGAAAAGGAGAAAGCTGGG + Intronic
1189862300 X:45286111-45286133 CTGGGGATAAGGAGATTACAGGG - Intergenic
1190217558 X:48490050-48490072 CTGAGGAAAAGGAGGGAGCCGGG + Intergenic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1191782836 X:64886789-64886811 CTGCAGAAGAGGAGAGGGCATGG + Intergenic
1192248441 X:69391698-69391720 ATGTGGAAGAGGGGAGAGCAGGG - Intergenic
1192438026 X:71154658-71154680 ATGTGGGAAAGGGGAGTGAATGG - Intronic
1193945820 X:87732903-87732925 CTATGCCAAAAGAGAGTGCAAGG + Intergenic
1194380609 X:93186530-93186552 ATGTGGGAAAGGAGTATGCAAGG + Intergenic
1195285277 X:103377074-103377096 CGGAGGAGAAGGAGACTGCAAGG + Exonic
1196969356 X:121092016-121092038 CTGTTCAAAAAGAGAGAGCAGGG - Intergenic
1199458309 X:148054227-148054249 CTGTGAAATAGGAAGGTGCATGG + Intergenic
1202386715 Y:24333471-24333493 CTGGAGAAAAGGACAGTGAATGG - Intergenic
1202484070 Y:25336657-25336679 CTGGAGAAAAGGACAGTGAATGG + Intergenic