ID: 1024063718

View in Genome Browser
Species Human (GRCh38)
Location 7:45716591-45716613
Sequence GCAACAGGGTTGGCTGTGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 235}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024063718_1024063728 11 Left 1024063718 7:45716591-45716613 CCTGGCACAGCCAACCCTGTTGC 0: 1
1: 0
2: 0
3: 18
4: 235
Right 1024063728 7:45716625-45716647 CTGCCCAGCTTCGGCCATCCAGG 0: 1
1: 0
2: 0
3: 12
4: 167
1024063718_1024063726 2 Left 1024063718 7:45716591-45716613 CCTGGCACAGCCAACCCTGTTGC 0: 1
1: 0
2: 0
3: 18
4: 235
Right 1024063726 7:45716616-45716638 CCAGTGCCGCTGCCCAGCTTCGG 0: 1
1: 1
2: 0
3: 16
4: 241
1024063718_1024063735 28 Left 1024063718 7:45716591-45716613 CCTGGCACAGCCAACCCTGTTGC 0: 1
1: 0
2: 0
3: 18
4: 235
Right 1024063735 7:45716642-45716664 TCCAGGTGGTGGGTAGACAGAGG 0: 1
1: 0
2: 3
3: 41
4: 266
1024063718_1024063733 18 Left 1024063718 7:45716591-45716613 CCTGGCACAGCCAACCCTGTTGC 0: 1
1: 0
2: 0
3: 18
4: 235
Right 1024063733 7:45716632-45716654 GCTTCGGCCATCCAGGTGGTGGG 0: 1
1: 0
2: 1
3: 9
4: 215
1024063718_1024063732 17 Left 1024063718 7:45716591-45716613 CCTGGCACAGCCAACCCTGTTGC 0: 1
1: 0
2: 0
3: 18
4: 235
Right 1024063732 7:45716631-45716653 AGCTTCGGCCATCCAGGTGGTGG 0: 1
1: 0
2: 0
3: 6
4: 96
1024063718_1024063730 14 Left 1024063718 7:45716591-45716613 CCTGGCACAGCCAACCCTGTTGC 0: 1
1: 0
2: 0
3: 18
4: 235
Right 1024063730 7:45716628-45716650 CCCAGCTTCGGCCATCCAGGTGG 0: 1
1: 0
2: 2
3: 10
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024063718 Original CRISPR GCAACAGGGTTGGCTGTGCC AGG (reversed) Exonic
900554329 1:3272253-3272275 GCAACAGAGTTGGCTGTAGTCGG + Intronic
900622981 1:3595899-3595921 GGGACCGGGTGGGCTGTGCCAGG + Intronic
900746815 1:4366285-4366307 GCAGCGGGGGTGGCTCTGCCTGG - Intergenic
900961538 1:5924746-5924768 GCAAGAGGATTGGTTGAGCCCGG - Intronic
901194330 1:7432004-7432026 GGACCAGGGTTGCCTCTGCCTGG - Intronic
903023568 1:20411337-20411359 GCAGCAGGGATGCCTGGGCCAGG - Intergenic
903384113 1:22915700-22915722 AAACCAGAGTTGGCTGTGCCTGG - Intergenic
903626138 1:24731548-24731570 GTAACAGCGTTGGCTAGGCCAGG + Intergenic
903778591 1:25808296-25808318 GCGCCTGGGTGGGCTGTGCCTGG + Intronic
905106831 1:35568455-35568477 GCAAGAGGAATGGCTGAGCCAGG + Intergenic
906525275 1:46489958-46489980 GCAAGAGGGGAGGCTGTCCCCGG - Intergenic
906573263 1:46862703-46862725 GCACCAGTGTTGGCTGCTCCAGG - Intergenic
907225405 1:52941621-52941643 GCTACTGGGGTGGCTGAGCCAGG + Intronic
910241652 1:85093160-85093182 GCTGCAGGGATGGCTGGGCCTGG - Intronic
914755561 1:150559873-150559895 GCTGCAGGGTTGGCTGTTACAGG - Exonic
919652855 1:200167382-200167404 GCAACAGGGTTTGCTGGCCTTGG - Intronic
920135422 1:203765380-203765402 GCAACAGGTTTGGTTCTACCTGG - Exonic
922725569 1:227921491-227921513 GCAGCAGGGCTGGCAGGGCCTGG + Exonic
923413123 1:233729727-233729749 GAAACAGGGCTGGCTGGGCGCGG + Intergenic
1063902532 10:10748916-10748938 GCAATAGGGTTTGCTGTGTTTGG + Intergenic
1064425162 10:15223785-15223807 GCAACTGGGGTGGCTGAGGCAGG + Intronic
1067055445 10:43047145-43047167 GCAGCAGGGATGGCAGTGGCTGG - Intergenic
1068137402 10:52964662-52964684 GCAACAGGGTGGGCAGTTCCAGG + Intergenic
1070504278 10:77099342-77099364 GCAACACCGTTGGGTGTGGCTGG - Intronic
1071478080 10:86042000-86042022 GCAAGAGGGTTGGCTTTGATTGG - Intronic
1071999974 10:91185427-91185449 GCAACACTGTTGTCCGTGCCTGG + Intronic
1072082791 10:92048511-92048533 GCCACAGGTTTGGCTGCACCTGG + Intronic
1072703594 10:97663533-97663555 GAAACAGGGTTGGCCGGGCATGG + Intronic
1073756197 10:106583470-106583492 GCAACAGGGAAAGCAGTGCCTGG - Intronic
1075546695 10:123360422-123360444 GCAACAGTGATGGCTGTGGAAGG - Intergenic
1076530393 10:131140878-131140900 GCAAGAGGCCTGGCTGTGCAGGG + Intronic
1077341945 11:2030166-2030188 GCCACAGCGCTGGCGGTGCCCGG + Intergenic
1079887395 11:26004745-26004767 GCAACAGAGCAGGCTGTGCAAGG - Intergenic
1081598137 11:44473420-44473442 GCCACTGGGTTGGCAGTGGCAGG - Intergenic
1081790457 11:45779604-45779626 GCAACGTGGTTGGCTGGGCGCGG - Intergenic
1081991712 11:47341527-47341549 GCAACTGGGCTGGCCGTGCTGGG - Intronic
1083155528 11:60820699-60820721 CCAAGATGGTTGGCTGTCCCCGG - Intergenic
1084374336 11:68765704-68765726 ACAACAGTATTGCCTGTGCCGGG - Intronic
1087041788 11:93808267-93808289 GCAGGAGGGTTGCCTGAGCCTGG + Intronic
1089169608 11:116502902-116502924 GTTACAGGGTTGTCAGTGCCAGG - Intergenic
1089366820 11:117925727-117925749 ACAACAAGGGTGGATGTGCCTGG - Intronic
1089378343 11:118010920-118010942 GCCACAGGTTTGGCTGAGCCAGG - Intergenic
1090509084 11:127353242-127353264 GCAAGAGGATTGACTGAGCCAGG - Intergenic
1090656841 11:128852701-128852723 GCTCCTGGGTGGGCTGTGCCCGG - Intronic
1202824931 11_KI270721v1_random:85355-85377 GCCACAGCGCTGGCGGTGCCCGG + Intergenic
1092052515 12:5482269-5482291 CCAAGAGGGGTGGCAGTGCCTGG - Intronic
1092449968 12:8593146-8593168 GCTACAGGGGAGGCTGTGGCAGG + Intergenic
1093272446 12:17081330-17081352 GGAACAGGGTTGGCAGGTCCAGG + Intergenic
1094652543 12:32391919-32391941 GAGACAGGGTTGGCTGGGCATGG + Intergenic
1099388425 12:82048121-82048143 GCAAGAGGATTGTCTGAGCCTGG - Intergenic
1100329436 12:93570689-93570711 GAAACGGGGTTGGCTGTAGCCGG + Intronic
1101910037 12:108854564-108854586 GCAGCAGGCCTGGCTGTGTCAGG + Intronic
1101911635 12:108864342-108864364 GCAACTGGGGTGGCTGAGGCAGG - Intronic
1103961431 12:124611443-124611465 GCTGCAGGTTGGGCTGTGCCTGG + Intergenic
1104808283 12:131603498-131603520 AGGACAGGGTTGGCTGGGCCAGG - Intergenic
1108930808 13:55815853-55815875 GCAACAGGCATGGCTCTGGCAGG - Intergenic
1111928829 13:94492460-94492482 GCAACATGACTGGCTATGCCTGG + Intergenic
1112148698 13:96731747-96731769 GCAAGAGGATTGCCTGAGCCAGG - Intronic
1113303782 13:109053765-109053787 GCCACAGGGGTGGCTGTGCATGG - Intronic
1118708689 14:68502423-68502445 GCAACAGGGCTGCCTTTGCAGGG + Intronic
1118740624 14:68737010-68737032 GGTACAGGGGTGCCTGTGCCAGG + Intergenic
1121171052 14:91854812-91854834 GCAATGGGGTGGGCTGAGCCAGG - Intronic
1123034772 14:105467442-105467464 GGGACAGGGTTGGCTGGGCTGGG - Intronic
1123065413 14:105616631-105616653 GGCACAGGCGTGGCTGTGCCGGG + Intergenic
1123069615 14:105636097-105636119 GGCACAGGCGTGGCTGTGCCAGG + Intergenic
1123088709 14:105731880-105731902 GGCACAGGCGTGGCTGTGCCGGG + Intergenic
1123094643 14:105761139-105761161 GGCACAGGCATGGCTGTGCCGGG + Intergenic
1125848309 15:42879766-42879788 GCAAGAGGGTTGCTTGAGCCCGG + Intronic
1126092386 15:45063556-45063578 CCAACACGGTTGGCTGTGTTGGG + Intronic
1127191321 15:56533861-56533883 GCAAGAGGGTTGTTTGTGCTTGG - Intergenic
1128178535 15:65579541-65579563 GCATCAGGGTGGGCTGTCTCAGG + Exonic
1128750965 15:70148737-70148759 ACAACTGGATTGGCTCTGCCTGG + Intergenic
1130369674 15:83274271-83274293 GCTACAGGGGAGGCTGAGCCAGG + Intronic
1130541940 15:84826756-84826778 GAAACATGGTTGGCTGCTCCAGG - Intronic
1130838739 15:87677556-87677578 TCAACAGAGTTGGCTCTTCCTGG + Intergenic
1132553143 16:561390-561412 GCGACAGAGGCGGCTGTGCCGGG - Intronic
1133039529 16:3052983-3053005 GCAGCAGGGATGGCAATGCCGGG + Intronic
1133043372 16:3072616-3072638 GCAGCAGGGATGGCAATGCCGGG + Intronic
1133170904 16:3982049-3982071 GCAGGAGGGGAGGCTGTGCCAGG + Intronic
1133439287 16:5807035-5807057 GCACCAGTGATGGCTGAGCCTGG + Intergenic
1133582354 16:7158056-7158078 ACTACAGGGTTGGCTGGGCGCGG + Intronic
1134135695 16:11675002-11675024 GCAACAGGGTAGAGTGTCCCGGG - Intronic
1134673560 16:16073661-16073683 GCAGGAGGATTGGCTGAGCCCGG + Intronic
1135899251 16:26441564-26441586 GCAACACAGCTGGCTGTGTCTGG + Intergenic
1137054355 16:35736170-35736192 TAAACAGGGTTGGGTTTGCCTGG + Intergenic
1137706101 16:50536903-50536925 GCAAGAGGGTTGCTTGAGCCTGG + Intergenic
1139432085 16:66916258-66916280 GCTACAGGTATGGCTGGGCCAGG - Exonic
1141787564 16:86211991-86212013 GCAGCAGGATTTCCTGTGCCAGG + Intergenic
1142176532 16:88647912-88647934 GACACAGGGTGGGCTGTGCACGG - Intronic
1142474156 17:180035-180057 GCAGCAGGGATGTCTGCGCCTGG - Intronic
1144390085 17:14785047-14785069 GCAGCAGGGTTGGCAGCTCCAGG - Intergenic
1145775003 17:27521523-27521545 GCAAGAGGCTTGCCTGAGCCCGG - Intronic
1145819350 17:27819607-27819629 GCAAGAGGGTTGCTTGAGCCCGG + Intronic
1146788954 17:35740957-35740979 CCAGCAGGGCAGGCTGTGCCTGG - Intronic
1146846345 17:36183795-36183817 GCAACAGGGGTGTCTGCGCTGGG + Intronic
1147502692 17:40980781-40980803 GCACCAGGCTTTGCTGTGCTTGG + Exonic
1148429951 17:47634690-47634712 CCCACAGGGTTGGCTGGGCGCGG + Intergenic
1149701839 17:58661749-58661771 GCAACGGAGTCGGTTGTGCCGGG + Intronic
1150659043 17:67059595-67059617 GGAAAATGGTTGGCTTTGCCAGG + Intergenic
1151091601 17:71446216-71446238 GCAACATGGTGGTATGTGCCAGG + Intergenic
1151878745 17:76881983-76882005 GCAAAAGGGTCAGCAGTGCCTGG + Intronic
1152698801 17:81809030-81809052 GCAGCAGGGGTCGCTGTGGCTGG - Exonic
1152737988 17:82006862-82006884 TCAACAGGGCTGGGTGTGGCTGG + Intronic
1152855244 17:82661971-82661993 GAAACAGCGCTGGCTGTCCCAGG - Intronic
1159770565 18:72542444-72542466 GAAAGCGGGTTGGCTGTGCGCGG - Intronic
1160264023 18:77323075-77323097 TCAACAGGATTGGCTGTGAGAGG + Intergenic
1160853346 19:1205407-1205429 GCCGCAGGGTGGGCTGAGCCCGG - Intronic
1161089146 19:2351672-2351694 GCCGCAGGGCTGGCTGTGGCTGG - Intronic
1161206745 19:3045410-3045432 GCAGCAGGATTGGCTGAGGCAGG - Intronic
1161649006 19:5472701-5472723 GCAAGGGGGTTGGCTGTGTAGGG + Intergenic
1161771828 19:6235125-6235147 GGAACGGGCTTGGCTGTGCAGGG + Intronic
1162082220 19:8225001-8225023 GCAGCAGGTTTGGCTTTGGCGGG + Intronic
1162506985 19:11091240-11091262 GCAAGGGGGTTGGCTTTGACTGG + Intronic
1163452473 19:17386521-17386543 GCTACACGGGAGGCTGTGCCAGG - Intergenic
1165404889 19:35623463-35623485 GCAACAGGGGTGGCTGAGTAAGG + Exonic
1166691892 19:44826905-44826927 GCAGCAGGGTTGATTGAGCCTGG + Intergenic
1167343066 19:48927609-48927631 GAAACAGGGTTGGCTGGGCGTGG - Intergenic
1167494573 19:49810086-49810108 GCAACAGGTTAGGGGGTGCCAGG + Intronic
926162092 2:10496213-10496235 GGACCAGGGTTGGGTGGGCCGGG - Intergenic
926304585 2:11628807-11628829 GCAGCCGGCTGGGCTGTGCCTGG + Intronic
926341029 2:11904383-11904405 TCCACAGGGGTGGCTCTGCCGGG + Intergenic
931493688 2:62778448-62778470 GCAAGAGGATTGGTTGAGCCTGG + Intronic
933801032 2:85960676-85960698 GCAGCAGGGTGGGCAGTTCCAGG + Intergenic
934567053 2:95346862-95346884 GCTGCTGGGTTGGCTGGGCCGGG - Intronic
935073513 2:99716939-99716961 GCAACAGGGGTTGCTGTGAGAGG - Intronic
937440650 2:121912631-121912653 GCAACCAGGTTTACTGTGCCAGG - Intergenic
937871314 2:126788230-126788252 GCAGCAGGGTGGGCTGGGCTGGG - Intergenic
940986687 2:160058278-160058300 GAAACAGGGTTGGGTGTACGGGG - Intronic
942194112 2:173500104-173500126 ACAACAAGTTTGGCTGTGCACGG + Intergenic
947845485 2:233240215-233240237 GCTTCAGGGTTGGCTGTGGATGG - Intronic
948316504 2:237031426-237031448 GCCACAGGGATGGCTTTGCTTGG - Intergenic
948658326 2:239490791-239490813 GGAACTGGGTTGGCTTTCCCCGG + Intergenic
948667320 2:239544911-239544933 GCAGGATGTTTGGCTGTGCCAGG + Intergenic
948961740 2:241344273-241344295 GCACCAGGGGTGGCTCAGCCTGG - Intronic
1169137232 20:3204499-3204521 GCACCAGGGTTGGTGGTACCGGG - Intronic
1169437004 20:5601657-5601679 GAGACAGGGTTGGCTGGGCATGG - Intronic
1172007887 20:31829978-31830000 ACTACAGGGTTGGCTCTTCCAGG - Intronic
1172885399 20:38227660-38227682 GCCACAGGGTTGGGTGTGGAGGG + Intronic
1173069568 20:39749832-39749854 GCACCAAGGTTTGCTGTGGCTGG + Intergenic
1173494362 20:43507962-43507984 GCCGCAGGGTCGGCTGGGCCTGG - Intronic
1174442859 20:50569894-50569916 GCAGCAGGGTTGGCAGTGTTGGG - Intronic
1174465868 20:50716881-50716903 GAAACAGGGTTGGCTGGGCGTGG + Intergenic
1175276652 20:57775216-57775238 GCAGGTGGGTAGGCTGTGCCAGG + Intergenic
1176157799 20:63631005-63631027 GAAACTGGGTTGGCTGGGCATGG + Intergenic
1176977114 21:15334845-15334867 GCAACAGGGATGAATGTCCCTGG - Intergenic
1177317198 21:19477384-19477406 GAAACATGGTTTGCTGGGCCAGG - Intergenic
1179599568 21:42467183-42467205 GCAGAAGGGTTGGCTCTGGCAGG - Intergenic
1179715818 21:43287612-43287634 ACATCTGGGTTGGCTGTGTCCGG + Intergenic
1180197902 21:46208428-46208450 GCACCAGTGGTGGCTGTGGCCGG - Intronic
1182298617 22:29325928-29325950 GCAACAGCCTTGGCAGTGTCTGG + Intergenic
1183436017 22:37795721-37795743 GCTAAAGGGTTGGCTGTGGGGGG - Intergenic
1183769777 22:39913984-39914006 GGAAAAGGGGTGGCTGTGCTTGG - Intronic
1184265228 22:43342943-43342965 GCACCAGGGGTGGGTGGGCCGGG - Intronic
949783736 3:7718065-7718087 GCCCCAGGGTTGGCTGAGCTAGG - Intronic
950124029 3:10500689-10500711 CCAGCAGGGTTGGCTTTTCCTGG - Intronic
950595502 3:13977332-13977354 ACAACAGGGTCAGATGTGCCAGG - Intronic
952410645 3:33047007-33047029 GCAGCTGGGTTGGCTGTTCGAGG - Intronic
953454866 3:43033180-43033202 GGAACAGAGTTGGCTGAGCCTGG - Exonic
953930241 3:47002367-47002389 GGGACATGGTTGGCTGTACCTGG - Exonic
954025764 3:47781906-47781928 GGAAGAGGGTTGGCTGGGCGGGG - Exonic
954687970 3:52380705-52380727 GGAACAGGGTATGCTGTGGCAGG + Intronic
954699298 3:52443107-52443129 GCCCCAGGGTAGGCTGGGCCAGG - Intronic
954700951 3:52450701-52450723 GTAACAGGGGTTGCTGTGCCAGG + Intergenic
954803031 3:53198378-53198400 TCAACAGGCATGACTGTGCCTGG + Intergenic
954819961 3:53317453-53317475 GACACAGGGTTGGCTGGGCGCGG - Intronic
955198186 3:56825234-56825256 GCTACTTTGTTGGCTGTGCCAGG - Intronic
955216374 3:56987728-56987750 GCTGCAGGATTGGCTGTGCACGG - Intronic
956089374 3:65649286-65649308 GCAGGAGGGTTGCCTGAGCCCGG + Intronic
956707265 3:72010134-72010156 GCAGAAGCGTGGGCTGTGCCGGG + Intergenic
959486220 3:106929815-106929837 GAAACAGTGTAGGGTGTGCCAGG - Intergenic
960447919 3:117770419-117770441 ACAAATGGCTTGGCTGTGCCTGG - Intergenic
960513733 3:118580176-118580198 CCAAGAGTGTTGGCTGAGCCAGG - Intergenic
960832939 3:121869646-121869668 GCAAGAGGGTTGCTTGAGCCCGG + Intronic
961576860 3:127844173-127844195 GAGACAGGGTTGGCTGGGCGCGG - Intergenic
962609569 3:137063009-137063031 GACTCAGGGTTGGCTATGCCAGG + Intergenic
964223426 3:154370608-154370630 GCAACAGGACTGAATGTGCCTGG + Intronic
964927715 3:161978056-161978078 GCAACGGGGTGGGCAGTACCAGG + Intergenic
965209460 3:165766830-165766852 GCATCAGAGTTGGCTGGGCATGG - Intergenic
966316524 3:178652772-178652794 GCAACACGGGAGGCTGTGGCAGG - Intronic
968335195 3:197907678-197907700 ACAACAGGGGTGACTGTACCAGG + Intronic
968728177 4:2257871-2257893 GCAGCACGGCTGGCCGTGCCCGG + Intronic
968736183 4:2297700-2297722 GCGACATGGTTGGCTGTGCTGGG + Intronic
968983457 4:3863208-3863230 ACAAGAGTGCTGGCTGTGCCTGG - Intergenic
969675771 4:8613611-8613633 CCCACAGGGCTGGCTGTGTCGGG - Intronic
975000767 4:69221847-69221869 GCAACAGGACTGAGTGTGCCTGG - Intergenic
975072476 4:70158844-70158866 GCAGCAGGCTTGGCTGTAGCAGG - Exonic
979382079 4:120019095-120019117 GCAACAGGCTTGTCTGGGCAGGG - Intergenic
982106441 4:152015650-152015672 GGCACAGGGTTGGCTGTGCATGG - Intergenic
985635891 5:1035784-1035806 GCAACAGGGCTGGGGGTGGCTGG + Intronic
985866360 5:2517378-2517400 GCACGAGGGTTGGCTCTGCCAGG - Intergenic
987313259 5:16700902-16700924 GCAACAGGGGTGGGTGTGACCGG + Intronic
987451774 5:18093822-18093844 GCCACAGGCTTGACTGGGCCAGG - Intergenic
989253517 5:39342657-39342679 GCTACAGGAATGGCTGGGCCTGG - Intronic
992049462 5:72929486-72929508 GCAACAGGATTGAGGGTGCCTGG + Intergenic
992089157 5:73302616-73302638 GCTATAGGGTTGGCTGGGCATGG + Intergenic
994071441 5:95607667-95607689 GCAACAGGGATGCATGTGGCTGG - Intergenic
998213637 5:140220620-140220642 TCTGCAGGGTTGGCTGTGTCAGG + Intronic
998393515 5:141803309-141803331 GCTTCATGGCTGGCTGTGCCAGG + Intergenic
999195610 5:149779645-149779667 GCAACAGGGAAGCCTGTTCCAGG + Intronic
999981996 5:156966750-156966772 GCAACAGGATTGCTTGAGCCTGG - Intergenic
1001190515 5:169626374-169626396 GCAAGAGGGTTGCTTGAGCCTGG + Intergenic
1001846146 5:174923107-174923129 GCAACAGGATTGGCCCAGCCGGG - Intergenic
1002385015 5:178860132-178860154 GCGGCATGGCTGGCTGTGCCGGG + Intronic
1002813236 6:654690-654712 GCTACAGGGGAGGCTGTGGCAGG + Intronic
1003597067 6:7482893-7482915 GAGACGGGGTTGGCTGTGGCTGG - Intergenic
1006190347 6:32203833-32203855 AAAGCAGGGTTGGCTGTGGCAGG + Exonic
1006777650 6:36608326-36608348 GCAACTGGGGAGGCTGAGCCAGG + Intergenic
1007146139 6:39634518-39634540 GCAACAGGGTTTCATGTGGCAGG + Intronic
1007496317 6:42262294-42262316 GCATAAGGGTAGGCTGGGCCAGG - Intronic
1013009052 6:106103665-106103687 GAGACAGGGCTGGCTGTGGCAGG + Intronic
1014262408 6:119234641-119234663 GCAAAAGGATTGCCTGAGCCTGG - Intronic
1014968876 6:127790823-127790845 GCAGCAGGGTGGGCAGTGCCAGG + Intronic
1015980897 6:138837406-138837428 GTAACAGGGTTTGCTCAGCCTGG - Intronic
1016384410 6:143516500-143516522 GCACCAGGGTTGTCAGTGGCAGG + Intergenic
1017021995 6:150147466-150147488 CCACCAGGGTTGGCTGGGCGCGG - Intronic
1018734501 6:166677452-166677474 GCAAGAGGGTTGCTTGAGCCTGG - Intronic
1019183918 6:170209849-170209871 GGAACAGCCTGGGCTGTGCCTGG - Intergenic
1019615221 7:1956377-1956399 GCAACAGGGACAACTGTGCCCGG - Intronic
1019904098 7:4047886-4047908 GACACAGGGCTTGCTGTGCCTGG - Intronic
1020200732 7:6077796-6077818 GCAACTTGGTTGGCTGAGGCAGG - Intergenic
1022256246 7:28661260-28661282 GCAGCAGAGTGGGCTGTACCAGG - Intronic
1022823425 7:33984125-33984147 GCAATAAGGGTGGCTCTGCCCGG - Intronic
1023443950 7:40212329-40212351 GCAAGAGGATTGCTTGTGCCAGG + Intronic
1023828804 7:44027789-44027811 GGAAGGAGGTTGGCTGTGCCAGG + Intergenic
1024063718 7:45716591-45716613 GCAACAGGGTTGGCTGTGCCAGG - Exonic
1024565012 7:50673649-50673671 GCAGCAGGGTTGGCAGAGCATGG - Intronic
1026190787 7:68124522-68124544 GTCAGAGGGTTGTCTGTGCCAGG + Intergenic
1027400665 7:77802626-77802648 GCAACAGGATTGCCTGAGCCTGG - Intronic
1027885859 7:83904109-83904131 GCACCTGGGTTGGCAGTGCCTGG - Intergenic
1029217302 7:98959834-98959856 GCAGGAGGGTTGGCTGAACCTGG + Intronic
1037919816 8:22797907-22797929 GGTACAGGGCTGGCTGTGCACGG + Intronic
1039299389 8:36193218-36193240 GCAATAGGGTGGGGTGTGACAGG - Intergenic
1040488072 8:47893259-47893281 ACAAGAGGGTGGGCTGGGCCAGG + Exonic
1046968024 8:120189198-120189220 TCAACAGGTTTGCCTGTGCCAGG - Intronic
1047753616 8:127901116-127901138 CCAACAGCGTTGTCTGGGCCTGG + Intergenic
1048692945 8:136988838-136988860 GCTACAGGCAAGGCTGTGCCTGG + Intergenic
1049189495 8:141279008-141279030 TCCACAGGCTTGGCTGGGCCTGG + Intronic
1049413983 8:142487168-142487190 GCACCAGGGTGGGCTGTGGCAGG - Intronic
1049835629 8:144733855-144733877 GCAACGGTGTTAGCTGTTCCAGG - Intronic
1050552629 9:6761119-6761141 GCTACTGGGTTGGCTGAGGCAGG - Intronic
1057266567 9:93621528-93621550 GCAAGTGGATTGGCTGTGCCAGG + Intronic
1058425695 9:104874016-104874038 GCAAGATAGTTGGCTGTGGCAGG - Intronic
1058608498 9:106749695-106749717 GCAACAGTGCTGGCTGAGCTGGG + Intergenic
1059251958 9:112893909-112893931 GCAGGAGGATTGGCTGAGCCCGG - Intergenic
1060966343 9:127714335-127714357 GCAACTGGGTCGGGTGGGCCAGG - Intronic
1061763174 9:132864468-132864490 TCAACAGAGCTGACTGTGCCTGG + Intronic
1062465063 9:136677315-136677337 GACACAGGGCTGCCTGTGCCTGG - Intronic
1185592363 X:1285980-1286002 GCAACAGGGCCGGCTGGGCGCGG + Intronic
1186585312 X:10867132-10867154 GGAACAGGGTTAGGGGTGCCTGG + Intergenic
1187394123 X:18905463-18905485 GCAAAAGTGTTGGCTGGGCTCGG - Intronic
1189362881 X:40366827-40366849 GCAACAAGGGTGGCTGTGGGTGG - Intergenic
1189725033 X:43959707-43959729 GCACCAGTGTTGGCTATGCCTGG - Intronic
1195143410 X:101987251-101987273 GCAAGAGGATTGCCTGAGCCTGG + Intergenic
1197932338 X:131708937-131708959 ACAACAGAGTTGGCTGGGCATGG - Intergenic