ID: 1024067431

View in Genome Browser
Species Human (GRCh38)
Location 7:45752368-45752390
Sequence AAGGAGAAGGAGGATGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024067431_1024067438 7 Left 1024067431 7:45752368-45752390 CCATTCTCATCCTCCTTCTCCTT No data
Right 1024067438 7:45752398-45752420 CTAATTCCTATTCATCCTTTAGG 0: 2
1: 3
2: 17
3: 91
4: 458
1024067431_1024067440 14 Left 1024067431 7:45752368-45752390 CCATTCTCATCCTCCTTCTCCTT No data
Right 1024067440 7:45752405-45752427 CTATTCATCCTTTAGGACACTGG 0: 2
1: 0
2: 0
3: 22
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024067431 Original CRISPR AAGGAGAAGGAGGATGAGAA TGG (reversed) Intergenic
No off target data available for this crispr