ID: 1024072306

View in Genome Browser
Species Human (GRCh38)
Location 7:45796458-45796480
Sequence CTGGCTAATGTTTCTTTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024072292_1024072306 29 Left 1024072292 7:45796406-45796428 CCACCCCAGACTCCCAAGTAGCT 0: 33
1: 496
2: 14727
3: 30337
4: 46849
Right 1024072306 7:45796458-45796480 CTGGCTAATGTTTCTTTTTTTGG No data
1024072291_1024072306 30 Left 1024072291 7:45796405-45796427 CCCACCCCAGACTCCCAAGTAGC 0: 31
1: 494
2: 16352
3: 113220
4: 215481
Right 1024072306 7:45796458-45796480 CTGGCTAATGTTTCTTTTTTTGG No data
1024072295_1024072306 25 Left 1024072295 7:45796410-45796432 CCCAGACTCCCAAGTAGCTGGAA No data
Right 1024072306 7:45796458-45796480 CTGGCTAATGTTTCTTTTTTTGG No data
1024072300_1024072306 16 Left 1024072300 7:45796419-45796441 CCAAGTAGCTGGAACTACGGGTG 0: 29
1: 1597
2: 33463
3: 109179
4: 135297
Right 1024072306 7:45796458-45796480 CTGGCTAATGTTTCTTTTTTTGG No data
1024072294_1024072306 26 Left 1024072294 7:45796409-45796431 CCCCAGACTCCCAAGTAGCTGGA 0: 85
1: 6786
2: 109153
3: 219239
4: 254838
Right 1024072306 7:45796458-45796480 CTGGCTAATGTTTCTTTTTTTGG No data
1024072296_1024072306 24 Left 1024072296 7:45796411-45796433 CCAGACTCCCAAGTAGCTGGAAC No data
Right 1024072306 7:45796458-45796480 CTGGCTAATGTTTCTTTTTTTGG No data
1024072299_1024072306 17 Left 1024072299 7:45796418-45796440 CCCAAGTAGCTGGAACTACGGGT 0: 25
1: 987
2: 20064
3: 110438
4: 252345
Right 1024072306 7:45796458-45796480 CTGGCTAATGTTTCTTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024072306 Original CRISPR CTGGCTAATGTTTCTTTTTT TGG Intergenic
No off target data available for this crispr