ID: 1024073109

View in Genome Browser
Species Human (GRCh38)
Location 7:45802760-45802782
Sequence TCTCAACACCACCACGACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024073109_1024073123 27 Left 1024073109 7:45802760-45802782 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 1024073123 7:45802810-45802832 GAGGCCAGGGAGTTACTGGGTGG No data
1024073109_1024073112 -10 Left 1024073109 7:45802760-45802782 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 1024073112 7:45802773-45802795 GGTGTTGAGAGATGGTCAGAGGG No data
1024073109_1024073122 24 Left 1024073109 7:45802760-45802782 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 1024073122 7:45802807-45802829 GAGGAGGCCAGGGAGTTACTGGG No data
1024073109_1024073120 14 Left 1024073109 7:45802760-45802782 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 1024073120 7:45802797-45802819 AGAAGTAGGGGAGGAGGCCAGGG 0: 13
1: 15
2: 15
3: 78
4: 777
1024073109_1024073125 29 Left 1024073109 7:45802760-45802782 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 1024073125 7:45802812-45802834 GGCCAGGGAGTTACTGGGTGGGG No data
1024073109_1024073113 -9 Left 1024073109 7:45802760-45802782 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 1024073113 7:45802774-45802796 GTGTTGAGAGATGGTCAGAGGGG No data
1024073109_1024073114 0 Left 1024073109 7:45802760-45802782 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 1024073114 7:45802783-45802805 GATGGTCAGAGGGGAGAAGTAGG No data
1024073109_1024073115 1 Left 1024073109 7:45802760-45802782 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 1024073115 7:45802784-45802806 ATGGTCAGAGGGGAGAAGTAGGG No data
1024073109_1024073117 5 Left 1024073109 7:45802760-45802782 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 1024073117 7:45802788-45802810 TCAGAGGGGAGAAGTAGGGGAGG No data
1024073109_1024073121 23 Left 1024073109 7:45802760-45802782 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 1024073121 7:45802806-45802828 GGAGGAGGCCAGGGAGTTACTGG No data
1024073109_1024073119 13 Left 1024073109 7:45802760-45802782 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 1024073119 7:45802796-45802818 GAGAAGTAGGGGAGGAGGCCAGG 0: 13
1: 15
2: 16
3: 96
4: 958
1024073109_1024073118 8 Left 1024073109 7:45802760-45802782 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 1024073118 7:45802791-45802813 GAGGGGAGAAGTAGGGGAGGAGG No data
1024073109_1024073124 28 Left 1024073109 7:45802760-45802782 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 1024073124 7:45802811-45802833 AGGCCAGGGAGTTACTGGGTGGG No data
1024073109_1024073116 2 Left 1024073109 7:45802760-45802782 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 1024073116 7:45802785-45802807 TGGTCAGAGGGGAGAAGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024073109 Original CRISPR TCTCAACACCACCACGACCC TGG (reversed) Intergenic
No off target data available for this crispr