ID: 1024075609

View in Genome Browser
Species Human (GRCh38)
Location 7:45816453-45816475
Sequence GCTGCTGGGGCAGCATGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 527
Summary {0: 1, 1: 21, 2: 12, 3: 55, 4: 438}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024075609_1024075616 11 Left 1024075609 7:45816453-45816475 CCTGCTCATGCTGCCCCAGCAGC 0: 1
1: 21
2: 12
3: 55
4: 438
Right 1024075616 7:45816487-45816509 CCTGCTCCAGTCCAGCCTCTGGG 0: 1
1: 17
2: 14
3: 44
4: 401
1024075609_1024075614 10 Left 1024075609 7:45816453-45816475 CCTGCTCATGCTGCCCCAGCAGC 0: 1
1: 21
2: 12
3: 55
4: 438
Right 1024075614 7:45816486-45816508 ACCTGCTCCAGTCCAGCCTCTGG 0: 1
1: 17
2: 12
3: 32
4: 321
1024075609_1024075619 24 Left 1024075609 7:45816453-45816475 CCTGCTCATGCTGCCCCAGCAGC 0: 1
1: 21
2: 12
3: 55
4: 438
Right 1024075619 7:45816500-45816522 AGCCTCTGGGACCCATGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024075609 Original CRISPR GCTGCTGGGGCAGCATGAGC AGG (reversed) Intergenic
900013316 1:133662-133684 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
900043380 1:489649-489671 GCTGCTAGGGCAGCATGGGCAGG + Intergenic
900064818 1:724646-724668 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
900240611 1:1615723-1615745 GCTGCTGGGCCAGCGGGAGCGGG - Intronic
900255706 1:1697424-1697446 CCTTCTGGGGCAGGATGTGCTGG + Intronic
900554318 1:3272197-3272219 GCTGCAGATGCAGGATGAGCAGG - Intronic
900978080 1:6029603-6029625 GCAGCGGGGGCTGCAGGAGCTGG - Intronic
900990206 1:6095210-6095232 GCTGCTGGGCCAGCCTGCTCCGG + Intronic
901057200 1:6454163-6454185 GCTGCTGCGGCGGCAAGAACAGG - Intronic
901095845 1:6678762-6678784 GCTGCTTGGGAAGCTAGAGCAGG - Intronic
902224548 1:14988385-14988407 CCTGCTGGCTCAGCCTGAGCAGG + Intronic
902477164 1:16694328-16694350 GCTGCTGCGGCGGCAAGAACAGG + Intergenic
902921086 1:19666239-19666261 GCTGCTGGGCTGGCACGAGCTGG + Exonic
903112681 1:21150174-21150196 GCTGCTGCTGCAGCAGGGGCGGG - Intronic
903157816 1:21460116-21460138 GCTGCTGGGGCCGCCTGGGCTGG + Intronic
903261706 1:22135097-22135119 GCTGCTAGGACATCAAGAGCTGG + Intronic
903596214 1:24497023-24497045 GATGCTCGGGAAACATGAGCTGG - Intergenic
903861081 1:26364870-26364892 GGTCTTGGGGCAGCATGAGGAGG + Exonic
904487142 1:30833419-30833441 GCTACTGGGGCATCAAGAGACGG + Intergenic
905933469 1:41806192-41806214 GCTGCTGGTGCAGGCTGAGAGGG - Intronic
906616424 1:47235674-47235696 GGAACTGGGGCAGCAAGAGCAGG + Intergenic
906953008 1:50349625-50349647 GCAGGTGGGGCTGAATGAGCTGG - Intergenic
907251994 1:53145794-53145816 GCTTCTGGGGAGGCTTGAGCTGG + Intergenic
907417110 1:54322180-54322202 GCTGCTGGGACAGGCTGACCAGG + Intronic
907439901 1:54472719-54472741 GCTGCTGGGGAGCCATGGGCTGG + Intergenic
907509756 1:54949419-54949441 GCTCCTGGGCCAGCATGTGCAGG - Intergenic
908339358 1:63160812-63160834 GCTGCTGGCACAGCTTGATCTGG + Intergenic
908813524 1:68008747-68008769 GCGGCTGGGGAAGCTTGAACTGG - Intergenic
913544401 1:119853269-119853291 GCTGCTGGGGCCGCCTGGGCTGG - Intergenic
913570066 1:120110854-120110876 GCTGCTGGGGAGACATCAGCCGG + Intergenic
913602399 1:120434104-120434126 GCTGCTGGGGCCGCCTGGGCTGG + Intergenic
913991785 1:143620052-143620074 GCTGCTGGGGCCGCCTGGGCTGG - Intergenic
914084650 1:144442533-144442555 GCTGTTGGGGCCGCCTGGGCTGG - Intronic
914190659 1:145407699-145407721 GCTGCTGGGGCCGCCTGGGCTGG - Intergenic
914290875 1:146271820-146271842 GCTGCTGGGGAGACATCAGCCGG + Intergenic
914363572 1:146957710-146957732 GCTGCTGGGGCCGCCTGGGCTGG + Intronic
914463940 1:147909500-147909522 GCTGCTGGGGTTGGAGGAGCGGG - Intergenic
914488105 1:148129424-148129446 GCTGCTGGGGCCGCCTGGGCTGG - Intronic
914551919 1:148722603-148722625 GCTGCTGGGGAGACATCAGCCGG + Intergenic
914588466 1:149084543-149084565 GCTGCTGGGGCCGCCTGGGCTGG - Intronic
915246316 1:154558517-154558539 GCCGCAGGGGCAGCAGCAGCCGG - Exonic
915324173 1:155072041-155072063 GCTGCTGTGGCAGCTTGGGTGGG + Intergenic
916555379 1:165890230-165890252 GCTCCTGGGGCAGAATGAGGTGG + Exonic
918076331 1:181174002-181174024 GCTGCTGGGGCAGCATCCCCAGG + Intergenic
918120311 1:181532397-181532419 TATGCTGGGGCAGCATGATGTGG + Intronic
918890330 1:190258140-190258162 GCAGCTGGGGAAGCTTGAACTGG - Intronic
919787420 1:201268689-201268711 GCTGCTGAGGCAGCTGGATCAGG - Intergenic
921004146 1:211076070-211076092 GCAGCTGGGGAAGCTTGAACTGG + Intronic
921348828 1:214214661-214214683 GCTGCTGGTGAAGCAGGAGGAGG - Intergenic
921688887 1:218124236-218124258 GCTGCTGGGGAAGGATGCCCTGG - Intergenic
922099723 1:222470665-222470687 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
922261757 1:223950160-223950182 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
922565335 1:226597894-226597916 GCTACTGGGGCAGCCAGAGCAGG + Intronic
922735323 1:227975585-227975607 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
924342922 1:243052332-243052354 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
1063445531 10:6112261-6112283 GGGTCTGGGGAAGCATGAGCAGG + Exonic
1064582708 10:16810447-16810469 GCTGCTGGGGGAACAGCAGCAGG - Intronic
1065917336 10:30364835-30364857 ACTGCTGGAGCTGCAGGAGCTGG - Intronic
1066492114 10:35903854-35903876 TATGATGGGGCAGCATGAGCTGG - Intergenic
1066733561 10:38453220-38453242 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
1067062105 10:43082856-43082878 GCTGGAGGTGCAGCATGAGCTGG + Intronic
1067078365 10:43200684-43200706 GCTGCTGGGCCAGCACCAGGGGG + Exonic
1067111970 10:43407554-43407576 GCAGCCGGCGCAGCAGGAGCCGG + Intronic
1067216702 10:44310004-44310026 GACGCGGGGGCAGCATCAGCCGG + Intergenic
1068658365 10:59596972-59596994 GCTTCTGGGGCAGCACAACCAGG + Intergenic
1069024203 10:63521911-63521933 GCTGCGCGGGGAGCAGGAGCGGG - Intronic
1071847594 10:89535926-89535948 GCTGGCGGGGCTGAATGAGCCGG - Intronic
1072710713 10:97714113-97714135 GCTGCTGGGCAAGCACGAGCTGG + Exonic
1072811874 10:98468204-98468226 GCATCTGGGGCAGCTTGAACAGG + Intronic
1073043072 10:100620600-100620622 GCTGCTAGGGAGGGATGAGCGGG + Intergenic
1074391028 10:113058284-113058306 CCAGCTTGGGCAGCCTGAGCAGG + Intronic
1075102995 10:119519123-119519145 GCTGCCTGGGCAGCGTCAGCCGG - Intronic
1075612284 10:123863709-123863731 GCTTCTGGGACAGCATGAGAAGG - Intronic
1075729491 10:124627791-124627813 CCGGCTGGGGCAGGCTGAGCAGG - Intronic
1075833209 10:125428615-125428637 TCTGCTGGGGTTGCCTGAGCAGG - Intergenic
1076751690 10:132546588-132546610 GCTGCTGGGGCAGCTTTCCCCGG + Intronic
1076871669 10:133197781-133197803 GCTGGTGGGGCAGCAGGGGCTGG - Intronic
1076875289 10:133212901-133212923 CCTGCTGTAGCAGCGTGAGCTGG - Exonic
1076875537 10:133213885-133213907 GCTGCTGGTGCAGGGTGGGCTGG - Intronic
1076969652 11:125866-125888 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
1077012253 11:384567-384589 TCCGCAGGGGCAGCAGGAGCAGG - Intergenic
1077332806 11:1990755-1990777 GCCTCTGAGGCAGCACGAGCAGG - Intergenic
1077481066 11:2814892-2814914 GCAGCTGGGTCAGCCTGACCAGG - Intronic
1077670724 11:4154788-4154810 GCTGGAGGAACAGCATGAGCAGG + Intergenic
1078144308 11:8712640-8712662 GCTGCTGGAGTGGCAGGAGCGGG - Exonic
1078988067 11:16613877-16613899 GCTGCTGGGCCAGTGTCAGCTGG - Intronic
1080346836 11:31335056-31335078 GCAGCTGGGGAAGCTTGAACGGG - Intronic
1080582594 11:33656407-33656429 GCTGTTGTGGTAGCCTGAGCTGG - Intronic
1081237050 11:40658916-40658938 ACTGCTGGGGCTGCATGCTCTGG + Intronic
1081526465 11:43931231-43931253 CCTGCTGGGGCGTCATGAGTGGG + Intronic
1081605899 11:44526845-44526867 GCTGCTGGGGGAGCCTTTGCTGG - Intergenic
1081864624 11:46352686-46352708 GCTGCGGGGGCAGTGTGTGCAGG + Intronic
1082180052 11:49106398-49106420 GCAGCTGGGGCAAGATGGGCAGG - Intergenic
1082810592 11:57476884-57476906 GGTGGTGGGGCACCAGGAGCAGG - Exonic
1082823417 11:57560484-57560506 GCTGCTGGGGCAGGGGGAGGGGG - Intronic
1083594993 11:63914954-63914976 ACTGCAGGGGCAGCAGGGGCAGG + Exonic
1083636873 11:64125555-64125577 GCTGCTGGCGGGGCAGGAGCAGG - Intronic
1083939761 11:65889294-65889316 ACGGCTGGGGCAGCATCAGTGGG - Intergenic
1084161524 11:67353012-67353034 GCTGCTGAGGCAGTTTGACCTGG - Exonic
1084611115 11:70203603-70203625 GCTGCTGGAGCAGAACGACCTGG + Exonic
1084860560 11:72015246-72015268 CCTGGTGGAGCAGCATAAGCGGG - Exonic
1084935591 11:72584910-72584932 CCTGCTGGATCAGAATGAGCTGG - Exonic
1086685439 11:89728529-89728551 TCAGCTGGGGCAACATGGGCAGG + Intergenic
1087319788 11:96643966-96643988 GCTGCTGGGGCAGGATATGCAGG + Intergenic
1087977774 11:104570973-104570995 GATTCTGTGACAGCATGAGCAGG - Intergenic
1089313148 11:117573364-117573386 GCTGCTGGGGCCGGCTGGGCAGG + Intronic
1090613277 11:128491004-128491026 GCCACTGTGCCAGCATGAGCAGG + Intronic
1091041443 11:132284969-132284991 CCACCTGGGGAAGCATGAGCAGG + Intronic
1202815789 11_KI270721v1_random:45931-45953 GCCTCTGAGGCAGCACGAGCAGG - Intergenic
1092488045 12:8919803-8919825 GCTGCTGCTGGAGCATGAACTGG - Exonic
1094496536 12:30992569-30992591 GCTCCTAGTGCAGCATGTGCTGG - Exonic
1094646243 12:32327535-32327557 ACTGACGGAGCAGCATGAGCGGG + Exonic
1095212377 12:39509463-39509485 TCTGCTGGGGCAAGATCAGCTGG + Intergenic
1096148611 12:49295307-49295329 GCTGCTGGAGAAGCGGGAGCTGG - Exonic
1096192329 12:49628037-49628059 GCTCCTGAGGCAGCTTGAGATGG + Intronic
1096196118 12:49649828-49649850 GCTGCTGCGGCAATATGAGCGGG - Exonic
1096946644 12:55414604-55414626 GCTGCTGCTGGAGCATGAACTGG + Intergenic
1100442216 12:94627551-94627573 GTGGCTGGGGCAGTGTGAGCAGG - Intronic
1101866389 12:108523515-108523537 GCTGCTGGGGCGGCAACTGCAGG + Exonic
1103392483 12:120584623-120584645 GCGGCTGGCGCAGCCCGAGCCGG - Intergenic
1104201612 12:126595495-126595517 GCTGCTTGCGCAGCTTGAGGGGG - Intergenic
1105472211 13:20704175-20704197 GCAGCTGGGGCCGCGTGAGCAGG + Exonic
1105579653 13:21683327-21683349 GTGCCTGGGGCAGCATGAGAGGG + Intronic
1105764610 13:23547017-23547039 GGAGCTGGGGCAGGAAGAGCTGG - Intergenic
1108418877 13:50228602-50228624 GCTGCAGGGGCAGGTGGAGCTGG - Intronic
1109553283 13:63935274-63935296 GATGCAGGTGCAGAATGAGCAGG + Intergenic
1112821783 13:103346069-103346091 GCTGCTTGGCCAGAATCAGCTGG - Intergenic
1113587664 13:111476339-111476361 GCTGCTGGGCCACCATGCCCAGG - Intergenic
1113769363 13:112898567-112898589 GGCGCTGGGGCAGGAGGAGCAGG - Intronic
1116866930 14:50038832-50038854 GATGCTGGAGTTGCATGAGCTGG + Intergenic
1117444969 14:55795416-55795438 GCTGCAGGGACAGAATGAGGAGG + Intergenic
1118590944 14:67400533-67400555 GGTCCTGGGGCAGCACTAGCAGG + Intronic
1120688261 14:87563720-87563742 TCTGCTAGGGCAGCATGAAAGGG + Intergenic
1121436121 14:93921340-93921362 GGTGCTGGGGCTGGCTGAGCCGG + Intronic
1121967547 14:98324407-98324429 CCTGAAGGGTCAGCATGAGCAGG + Intergenic
1122772510 14:104103687-104103709 GCTGCAGGGGCAGGATGGCCGGG - Intronic
1123062955 14:105602392-105602414 GCTCCAGGGGCAGGATGGGCTGG - Intergenic
1123097706 14:105774254-105774276 GGTGGAGGGGCAGGATGAGCAGG - Intergenic
1123473713 15:20572324-20572346 GCTGCTGGAGCTGCAGGAGATGG + Intergenic
1123644296 15:22428029-22428051 GCTGCTGGAGCTGCAGGAGATGG - Intergenic
1123734013 15:23167335-23167357 GCTGCTGGAGCTGCAGGAGATGG + Intergenic
1123980480 15:25597449-25597471 GCTGCTGGTGGAGCAGGAACCGG - Intergenic
1124216123 15:27808302-27808324 GATGCTCGGGGAGCCTGAGCTGG + Intronic
1124284516 15:28388646-28388668 GCTGCTGGAGCTGCAGGAGATGG + Exonic
1124298181 15:28522968-28522990 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1124328823 15:28789549-28789571 GCTGCTGCGGCGCCATGATCTGG - Intergenic
1124959073 15:34381829-34381851 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1124975699 15:34528050-34528072 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1125051053 15:35298674-35298696 GGGTCTGGGGAAGCATGAGCAGG - Intronic
1125679215 15:41520474-41520496 GCTGCAGGGGCAGGAGGACCAGG + Exonic
1128377821 15:67089898-67089920 GGGGGTGGGGAAGCATGAGCTGG + Intronic
1128581635 15:68814512-68814534 GCTGGTGGTGCAGCAGCAGCAGG + Intronic
1128742786 15:70095641-70095663 GCTGCGAGGGCAGGAGGAGCCGG + Exonic
1128748951 15:70134827-70134849 GCTGCTGGGGTAGCTGGAGTAGG - Intergenic
1128787224 15:70406731-70406753 TCTCCTGGGCCAGCCTGAGCTGG + Intergenic
1129038671 15:72665980-72666002 GCTGCTGGAGCTGCAAGAGTTGG + Exonic
1129211220 15:74071250-74071272 GCTGCTGGAGCTGCAAGAGTTGG - Exonic
1129399183 15:75269837-75269859 GCTGCTGGAGCTGCAAGAGTTGG + Exonic
1129402790 15:75294113-75294135 GCTGCTGGAGCTGCAAGAGTTGG + Exonic
1129414817 15:75369695-75369717 ACTGCAGGGGCAGCAACAGCTGG + Exonic
1129476319 15:75786534-75786556 GCTGCTGGAGCTGCAGGAGCTGG + Intergenic
1129530652 15:76261633-76261655 GCTGCTGTGGCGGCAGCAGCAGG + Intronic
1129728353 15:77915524-77915546 TCTGCTGGAGCTGCAAGAGCTGG - Intergenic
1129883898 15:79025550-79025572 GATGCTGGGGCAGCAGCAGTGGG + Intronic
1130647434 15:85741315-85741337 GCAGCAGGGGCAGCAGGACCTGG + Exonic
1130780287 15:87030382-87030404 TCTACTGGGGCAGCTTGAACAGG + Intergenic
1130967861 15:88710453-88710475 GCTTCTGAGGCAACAGGAGCTGG + Intergenic
1130991604 15:88879069-88879091 GCTGCCGGGGCAACATGATGGGG + Exonic
1131047706 15:89326628-89326650 GGTGCTGGGGCCGCTTGGGCAGG + Exonic
1132746599 16:1438811-1438833 CCTGCAGGGGCAGCATGAGGTGG - Exonic
1134247633 16:12551837-12551859 GCTGCTGGGGACACAGGAGCAGG + Intronic
1134593409 16:15475736-15475758 CCTGCTGGGGTAGCATGGGTGGG - Intronic
1136018666 16:27425334-27425356 GGTGCTGTGGGAGCATGAGGAGG + Intronic
1136417578 16:30113179-30113201 GATGCTGGCGCAGCCTGGGCTGG - Intronic
1137053939 16:35734636-35734658 GCTGCTGTGGCACCAGGGGCTGG - Intergenic
1137644276 16:50060545-50060567 TCTGCTGGGGCAGCAGGAAATGG + Intergenic
1137795501 16:51214171-51214193 GCTGCTGCTGCAGCTTTAGCAGG + Intergenic
1139558542 16:67727735-67727757 GCTGCAGGTACAGGATGAGCCGG - Exonic
1139559103 16:67730363-67730385 CCAGCTGGGGCAACATGATCTGG + Intronic
1140125235 16:72112723-72112745 GCTGCCGGGGCAGCGGGAGGTGG + Exonic
1141154542 16:81588016-81588038 GTTCCTGGGGAAGCAAGAGCCGG - Intronic
1141677550 16:85525493-85525515 GCTGGCTGGGCATCATGAGCAGG - Intergenic
1141967532 16:87456398-87456420 GCTGCTGGGGCTACAGGTGCCGG - Intronic
1142220674 16:88853487-88853509 GCTGCTGTGGCAACAGGAGCTGG + Intronic
1142245763 16:88969418-88969440 GCTGCGGGGGTCGCAAGAGCGGG + Intronic
1142451024 16:90173256-90173278 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
1142456539 17:60439-60461 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
1143681598 17:8480117-8480139 GCTGGAGGAGCAGCTTGAGCAGG - Exonic
1144833291 17:18143601-18143623 GCTGCTGTGGGAGCAGGAGGTGG + Exonic
1146056066 17:29581814-29581836 GCAGGCGGGGCACCATGAGCTGG - Exonic
1147512627 17:41084451-41084473 GCAGCTGGGGCGGCAGCAGCTGG - Exonic
1147513882 17:41097773-41097795 GCAGCTGGGGCGGCAGCAGCTGG + Exonic
1147518902 17:41149468-41149490 GCAGCTGGGGCAGCAGCAGGTGG + Exonic
1148184774 17:45634181-45634203 GCAGCTGGAACAGAATGAGCAGG + Intergenic
1148764255 17:50028213-50028235 GAAGCTGGGGCAGCAGGAGAGGG - Intergenic
1148960095 17:51385465-51385487 GCGGCTGAGGCGGCATGACCAGG - Intergenic
1149458084 17:56805441-56805463 GTTGCTGGGGCAGGAGGAGTGGG - Intronic
1150302188 17:64055867-64055889 GCTGCTGCTGCTGCAGGAGCTGG + Exonic
1150427153 17:65086055-65086077 GCAGATGGGGGAGCAGGAGCCGG - Intergenic
1151370841 17:73645222-73645244 GCTGCGGGGGCAGCGTGAGCCGG + Intergenic
1151396284 17:73825216-73825238 GCTGTGGGGGCTGCCTGAGCAGG - Intergenic
1151681432 17:75624772-75624794 GCTGCAGGGGCCGCACCAGCTGG - Intergenic
1151732125 17:75917818-75917840 GCGGCTGGGCCAGCAGCAGCGGG - Exonic
1151958562 17:77392998-77393020 GCTCCTGGGGCAGGTGGAGCAGG - Intronic
1152221786 17:79072765-79072787 GCTGATGGGACAGCATGGTCAGG + Intergenic
1152587092 17:81193972-81193994 GCTGCGGGAGCAGCTGGAGCGGG - Exonic
1153367437 18:4273292-4273314 TATGCTGGGGAAGCAAGAGCGGG - Intronic
1154049030 18:10935796-10935818 GCTGCTGGCGAGGCAGGAGCAGG - Intronic
1156078955 18:33312454-33312476 ACTGCTGGGGCCTCATGAGCTGG - Intronic
1157605467 18:48923360-48923382 CCTGCTGGGGCAGCAGGATGCGG - Intronic
1160419102 18:78732007-78732029 GCTGCTGTGGCAGCTGGAGCAGG - Intergenic
1160561016 18:79755784-79755806 GCTGCAGGGGCAGCGAGAACGGG + Exonic
1160646457 19:195792-195814 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
1160701091 19:507773-507795 GCTGCTGCTGCAGCAGGAGCTGG - Exonic
1160972053 19:1773877-1773899 GCTGCTGGAGCAGGAAGAGCAGG + Intronic
1160996330 19:1883760-1883782 GCTGCTGGGGGAGAATGTCCTGG - Intronic
1161578969 19:5070344-5070366 GCTTCTGGTACGGCATGAGCGGG + Intronic
1161844947 19:6707100-6707122 GCTGCGGCGGCAGCACGCGCGGG - Exonic
1162302996 19:9854755-9854777 ACGGCTGGGGCAGCAGGTGCTGG + Exonic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1162895900 19:13764639-13764661 TCTGCTTGGGCAGCAGCAGCTGG - Exonic
1163137509 19:15323337-15323359 GCTGCTGGGGCACACTCAGCAGG - Intronic
1163287113 19:16355758-16355780 GCGGCTGCGGCGGCAGGAGCAGG - Exonic
1163702029 19:18790843-18790865 GCTGCTGCGGCAGCAGGTGCGGG - Exonic
1163766267 19:19165122-19165144 GGTGCTGGGGATGCAGGAGCAGG + Intronic
1164156983 19:22602983-22603005 GCTGCTGGAGTTGCAGGAGCTGG + Intergenic
1164520530 19:28975788-28975810 GCTCCTGGTGCAGAATGAACAGG - Intergenic
1164755519 19:30686206-30686228 GCTGCTACTGCAGAATGAGCTGG - Intronic
1164846677 19:31438512-31438534 GCTTCTGGGGGAACCTGAGCTGG + Intergenic
1165313355 19:35041250-35041272 GGGGCCGGGGCAGGATGAGCAGG + Intronic
1165453208 19:35896920-35896942 GCTGCTGGCCCAGGATGAGGAGG - Exonic
1165890455 19:39109107-39109129 GCTACTGGGGCCGCATGCGGTGG - Intronic
1165899306 19:39161469-39161491 GCAGAGGGGGCGGCATGAGCAGG - Intronic
1165920878 19:39297278-39297300 GATGAGGGGGGAGCATGAGCTGG - Intronic
1166213970 19:41323895-41323917 TCTGCTGGGGGAGCAGGAGCCGG - Exonic
1166369015 19:42291252-42291274 GCTGCTGGGGCAGCGTGGGCAGG - Exonic
1166544993 19:43628866-43628888 GCTGGTGGGGCAGCTGGGGCTGG - Intronic
1166673941 19:44727823-44727845 GTAGCTGGAGCAGGATGAGCTGG - Intergenic
1166700959 19:44881345-44881367 GTAGCTGGGGCAGAATGAGGCGG - Intronic
1166862174 19:45816875-45816897 GCTGCTGGGGCGGCAGCTGCAGG + Exonic
1167116748 19:47492981-47493003 GCTGCTGGAGCAGTATCAGAAGG - Exonic
1167156218 19:47740985-47741007 CCTGCTGCGGCAGGAGGAGCTGG + Exonic
1167867102 19:52337230-52337252 GGTGCTGGGACAGCAAGAGGGGG + Intronic
1168408069 19:56121020-56121042 GCTGCTGGGGGGGCGTGAGTGGG - Intronic
1168412519 19:56148554-56148576 GCTGGTCGGGCCGCATGAGAAGG - Intronic
1168631115 19:57956920-57956942 GGAGCTGGGGCAGCAGGAGGGGG - Intergenic
1202711180 1_KI270714v1_random:20154-20176 GCTGCTGCGGCGGCAAGAACAGG + Intergenic
925608593 2:5684108-5684130 GCTGCTGGGGAACCAGGAGATGG - Intergenic
925725209 2:6865390-6865412 GCAGCTGGTGCAGCAGGCGCTGG + Exonic
927081399 2:19634289-19634311 GCTGGAGGGGGAGCATGACCAGG - Intergenic
927196993 2:20554950-20554972 GATGCTGGGCCAGGAGGAGCTGG - Intergenic
927797574 2:26063907-26063929 GCTGCTTGGGCAGCTGAAGCAGG - Intronic
927980447 2:27371322-27371344 GCTCCTGGGGCTGCACGAGCAGG + Exonic
928366386 2:30706439-30706461 CCTGCTGGGGCCTCTTGAGCTGG - Intergenic
932749354 2:74361534-74361556 GCTCCTGGGTCAGCACCAGCCGG + Exonic
933354251 2:81194789-81194811 GCTGTTCAGGCAGCAGGAGCCGG - Intergenic
933722240 2:85405497-85405519 GGGGCTGGGGCAGCAGGATCAGG + Intronic
933792977 2:85897864-85897886 GCTGCTTGGCCAGTATTAGCAGG - Intergenic
933907190 2:86906458-86906480 GCTACTTGGGAAGCTTGAGCTGG + Intergenic
933908436 2:86916120-86916142 GCTACTTGGGAAGCTTGAGCTGG + Intronic
934024287 2:87987260-87987282 GCTACTTGGGAAGCTTGAGCTGG - Intergenic
935953091 2:108348910-108348932 GCATCTGTGGCAGCATAAGCAGG + Intergenic
936364927 2:111844955-111844977 GCTACTTGGGAAGCTTGAGCTGG - Intronic
936400807 2:112163144-112163166 GCAGCCGTGGCAGCCTGAGCTGG - Intronic
936979356 2:118249901-118249923 GGTGCTGGGGGAGTATGAGGAGG + Intergenic
937072667 2:119076056-119076078 GCTATTGAGGCAGCAGGAGCAGG - Intergenic
937913930 2:127089738-127089760 ACTGCTGGGGCAGAAGGTGCTGG + Intronic
942558703 2:177198447-177198469 GCTGCTGTGGCTGAAGGAGCTGG - Intergenic
945386615 2:209209331-209209353 GCAGCTGGGGCAGCCCGGGCCGG + Intergenic
946202117 2:218076480-218076502 GCTGCTGAGGGAGCAGGAGGGGG + Exonic
946363744 2:219235797-219235819 GCAGCAGAGGCAGCAGGAGCAGG + Exonic
948181978 2:235989460-235989482 GGTGCTGGGACAGGATGAGCTGG + Intronic
948526084 2:238571670-238571692 GCAGCTGCGGCAGCAACAGCGGG + Intergenic
948658499 2:239491806-239491828 GCTGCAGGGGCAGCATTTGTGGG + Intergenic
948907605 2:240987146-240987168 GCTGCTGGGGGTGGAGGAGCAGG + Intronic
1168958593 20:1852463-1852485 GGGGCTGGGGCAGGATGAGGAGG - Intergenic
1170972147 20:21126102-21126124 GCAGCGGCAGCAGCATGAGCCGG + Exonic
1171176438 20:23053475-23053497 GCTGATGGGGAAGCTTGAACTGG - Intergenic
1171245327 20:23606141-23606163 GGTGCTGGGGCAGCTGGGGCTGG - Intergenic
1171272705 20:23828843-23828865 GTGGCTGGGGCTGCATCAGCAGG + Intergenic
1171443506 20:25186506-25186528 GCGGCTGGGGAAGCTTGAACTGG - Intergenic
1172273577 20:33667890-33667912 CCTGCTGGGCCAGGCTGAGCAGG + Exonic
1173684006 20:44910103-44910125 GCTGCGGGGCAAGCAGGAGCCGG - Exonic
1173955535 20:47029495-47029517 TCTGCAGGGGAAGCATGATCAGG + Intronic
1174182442 20:48683282-48683304 GCTGCTGGGGCAGAAGAAGACGG + Intronic
1174449239 20:50609526-50609548 GCAGCAGGGGCAGCAAGAGCTGG - Intronic
1174741197 20:53015780-53015802 GCTGCTGGGACAGGATGGGAGGG + Intronic
1175225394 20:57441326-57441348 GCAGCTGGGCCAGCAGTAGCAGG + Intergenic
1175503567 20:59466899-59466921 GCGGCTGGGGCTGCAGGGGCAGG + Intergenic
1175678155 20:60965038-60965060 GCTGCTGGGGCTGCTAAAGCGGG - Intergenic
1175777716 20:61663588-61663610 GCTGCTGGGACGGCAGGACCGGG + Intronic
1175888961 20:62307657-62307679 GCTGCTGGAGCAGAAGGGGCTGG - Exonic
1176218154 20:63957844-63957866 GCTGCTGGGGCAGCCTCATGAGG - Exonic
1176279052 20:64290424-64290446 GCTCCTGGGTCAGCATGGGCAGG - Intergenic
1178246482 21:30957773-30957795 GCTGACTGGGCAGCAGGAGCAGG - Intergenic
1179913488 21:44462109-44462131 GCTGCTGGCCCAGCCTGTGCCGG + Exonic
1180150380 21:45944183-45944205 GGTGCAGGGGCAGCCAGAGCTGG + Intergenic
1180614707 22:17119960-17119982 GCCGCTGGGGCTGCAGCAGCAGG + Exonic
1180701157 22:17782087-17782109 GGTGCTGGGGCAGGGCGAGCAGG + Intergenic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1180841481 22:18960863-18960885 GCTGCTGGCGCGCCCTGAGCAGG + Intergenic
1180971670 22:19819230-19819252 GCTGCTGGGTAAGCAGGAGGTGG - Intronic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181530331 22:23513682-23513704 GGTGTTGGGGCGGCATCAGCGGG + Intergenic
1182517551 22:30867605-30867627 GTTGTTGGGGCAGGATGAGAAGG - Intronic
1183096096 22:35553198-35553220 GGTGGTGGGGCAGCAGGGGCGGG - Exonic
1183357899 22:37369283-37369305 GCAGCTGGGGCAGCAGCAGTGGG - Exonic
1183427511 22:37747367-37747389 CCTCCTGGGGGAGGATGAGCAGG + Intronic
1183431003 22:37765729-37765751 GCTGCAGCGGCACCACGAGCGGG + Exonic
1183988785 22:41584282-41584304 GCTTCTTGGGCAGCCTGAGCAGG + Exonic
1184040318 22:41939260-41939282 GCTGCAGGGGCTGCCAGAGCAGG + Intronic
1184263809 22:43335575-43335597 TCTGGTGGGGCTGCATGAGCTGG - Intronic
1184320532 22:43739240-43739262 GCTGCTGGGACAGCAAGATGAGG - Intronic
1184352323 22:43952346-43952368 GCTGGTGGGACTGCAGGAGCTGG - Intronic
1184365493 22:44048481-44048503 GCTACTGGGGAAGCTAGAGCAGG - Intronic
1184386607 22:44180132-44180154 TCTGCTGGTTCACCATGAGCTGG + Intronic
1184419317 22:44370366-44370388 GCTGCTGGCCCATCATGGGCTGG + Intergenic
1184460553 22:44635336-44635358 GCTGAGGAGGCAGCGTGAGCTGG + Intergenic
1184787403 22:46678479-46678501 TCTGCTGGGGCCGCCTGCGCTGG + Exonic
1184825776 22:46949903-46949925 GGGGCTGGAGCAGCCTGAGCAGG + Intronic
1185227533 22:49661395-49661417 GCTGTGGGGGCTGCAGGAGCTGG - Intergenic
1185230592 22:49678313-49678335 GCTGCCGGGGGTGCCTGAGCCGG - Intergenic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
950181848 3:10918938-10918960 GCTGGTGGGGCCACAGGAGCCGG - Intronic
950566188 3:13771042-13771064 GCAGCTGGAGCAGAGTGAGCAGG - Intergenic
953843712 3:46410231-46410253 GATGCTGGGCCAGCAGGAGGAGG - Intronic
953852646 3:46477984-46478006 GCTGCTGGGTTAGCTTGAGAAGG - Intronic
954408490 3:50358844-50358866 GCTGATGGAGCAGCATGTGTGGG - Exonic
954903989 3:54044091-54044113 GATGCTGTGGCAGCATGGACGGG + Intergenic
955624260 3:60899979-60900001 GCTGCTGGGGCCCAATGAGTGGG - Intronic
955927621 3:64023326-64023348 GGTGCTCGGGCAGGCTGAGCAGG + Exonic
958636173 3:96750201-96750223 GCTACTGGGGGACCAAGAGCAGG + Intergenic
959382711 3:105660690-105660712 GTTGCTGAGGCAGCAGGAGTGGG - Intronic
960057279 3:113284522-113284544 GCTGCTGGGGCTTCATGCCCGGG - Exonic
960704079 3:120465104-120465126 CCTTCTGGGGCTGCATGAGAAGG - Intergenic
961373111 3:126444113-126444135 GCTGCTGGGGCTTCGTGGGCAGG - Intronic
962250559 3:133833553-133833575 GCTGCTGGGGCAGGGCGGGCAGG - Intronic
962278624 3:134033754-134033776 GCTGCTGGGGAGGCAAGAGAAGG + Intronic
962890994 3:139672974-139672996 GCAGCTGTGGCAGGGTGAGCTGG - Intronic
965519774 3:169660880-169660902 GCAGCTGCGGCAGCAACAGCTGG + Intronic
965672060 3:171157546-171157568 GCAGCTGGAGCAGCAGCAGCGGG - Exonic
967232061 3:187348738-187348760 GAGGCTGGGGCAGCAGGAGTGGG + Intergenic
967281222 3:187825923-187825945 GCTGCTGGGGAAACAGGAGCAGG - Intergenic
968234704 3:197024730-197024752 GCTGCTGGGGAAGGAAGAGGGGG - Intronic
968371224 3:198223734-198223756 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
968453280 4:684942-684964 GGTGGTGGGGCAGGAGGAGCTGG - Intronic
968501633 4:952919-952941 GCTCCTGGGGCCGCATGTGGGGG - Intronic
968549603 4:1215271-1215293 GCTGCTGGGGCAGCTAGAGTGGG + Intronic
968726317 4:2249481-2249503 TCTGCTGCGGCAGCTTCAGCTGG - Exonic
968881915 4:3305293-3305315 ACTGCAGGGGCAGGATGACCAGG + Intronic
969625006 4:8297890-8297912 GCAGGTGGGGCTGCAGGAGCAGG - Intronic
970664307 4:18319337-18319359 GGTGCTGGGGGAGCAGGAGCGGG + Intergenic
973530934 4:51836208-51836230 GCTGGTGGGGTAGCATGAGTGGG + Intergenic
979259910 4:118636207-118636229 GCTGCTGGGGCAACATGGGCAGG - Intergenic
979328474 4:119404418-119404440 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
985577605 5:680904-680926 GCTGCTGGGTCTGGAGGAGCAGG + Intronic
985592535 5:773002-773024 GCTGCTGGGTCTGGAGGAGCAGG + Intergenic
985655806 5:1130859-1130881 GCGGCTGGGCCAGTCTGAGCCGG + Intergenic
985821932 5:2166415-2166437 CCTCCTGGAGGAGCATGAGCTGG - Intergenic
986648020 5:9937488-9937510 GCTGTTGGTGCAGCTTCAGCAGG + Intergenic
986896517 5:12377209-12377231 GCTGCTGGGTCAGCAAGGGTTGG + Intergenic
988961414 5:36375097-36375119 GCTGATGGGGAAGCAGGAGAGGG + Intergenic
989487469 5:42008842-42008864 GTTGATGGGAGAGCATGAGCTGG + Intergenic
991583197 5:68177796-68177818 GCTGATGGGGAAGAATGAGTAGG + Intergenic
992751907 5:79870044-79870066 TTTCCTGGGGCAGCATGAGCAGG + Intergenic
992956247 5:81911540-81911562 GCTGCTAGGGGAGCAAGGGCTGG - Intergenic
993501105 5:88667759-88667781 GCTGCTCGGGCAGCAGGCGTGGG - Intergenic
997912286 5:137888208-137888230 GCTGCTGGGAGAGGTTGAGCTGG + Intronic
998179493 5:139926562-139926584 GCTGCTGAGTAAGAATGAGCAGG + Intronic
998562194 5:143182048-143182070 CCTTCTGAGGCAGCAGGAGCAGG - Intronic
998887499 5:146709518-146709540 TCTACTGGGGAAGCAGGAGCGGG + Intronic
999264177 5:150255728-150255750 GCTGCTGAGGAAGCAGGAGCTGG + Intronic
999380359 5:151117165-151117187 GCTGCAGGGGCATCGTGAGGAGG - Exonic
1001065064 5:168529557-168529579 GCGGCTGGGGCAGCTGGGGCGGG + Exonic
1001382013 5:171311434-171311456 GTTGCAGCTGCAGCATGAGCCGG - Exonic
1001476952 5:172057348-172057370 GCTGCTGCGCAAGCATGAGAAGG - Exonic
1001924205 5:175624434-175624456 GCTGCTGGGACAGTTTGGGCTGG + Intergenic
1001999924 5:176191843-176191865 GCTGGGGGTGCAGCATGAGCCGG - Intergenic
1002134210 5:177098010-177098032 GACGCTGGGGCAGCAGCAGCAGG - Exonic
1002469832 5:179428720-179428742 GCAGCTTGGGCAGCAAGGGCAGG - Intergenic
1002503699 5:179664542-179664564 GCTCCAGGGGCAGCCTGTGCAGG + Intergenic
1002717098 5:181234487-181234509 GCTGCTGGGGCAGGTGGAGCCGG - Exonic
1002730463 5:181329280-181329302 GCTGCTAGGGCAGCATGGGCAGG - Intergenic
1002754069 6:144824-144846 GCTGCTGGGTCAGCATGGGCAGG + Intergenic
1003867341 6:10375504-10375526 GCTGTAGGGGAAGCATGAGAAGG - Intergenic
1004276673 6:14242628-14242650 TTTGTTGGGGCAGCATGAGGAGG - Intergenic
1004897599 6:20163760-20163782 GCTGCTGGGGAATCATCAGAAGG - Intronic
1005159986 6:22848216-22848238 GCTGCTGGGGCTACATGTGGAGG - Intergenic
1005246124 6:23887381-23887403 GCTGCTGGGGCAGAAGGGGATGG - Intergenic
1006321144 6:33320286-33320308 ACTGATGGGGGAGCATGAGAAGG - Intronic
1006630444 6:35426784-35426806 GCTGCTGGAGCAGGATCAGTTGG - Exonic
1008548323 6:52603343-52603365 GCTGTTAGGGGAGCATGAGCTGG + Intergenic
1009492771 6:64312440-64312462 GCTGTGGGGGCAGCTTCAGCAGG + Intronic
1010133645 6:72524304-72524326 TCTGCTGTGCCAGCAGGAGCAGG - Intergenic
1013155823 6:107490338-107490360 GCGGCGGCGGCAGCAGGAGCCGG + Exonic
1013181662 6:107721621-107721643 GCTGGTGGGTGAGCAAGAGCAGG - Intronic
1013366950 6:109443863-109443885 ACTCCTGGGGCAGCAGGAGGGGG + Exonic
1014068023 6:117150011-117150033 GATGCTGGGGCAGAATGATATGG - Intergenic
1014459806 6:121682911-121682933 GCTGCGGTGGCACCATGAGCGGG + Intergenic
1014676949 6:124378990-124379012 GCTGCTGTGGGAGGATGACCTGG + Intronic
1015870487 6:137771292-137771314 GGTGTTGGTGCAGCATAAGCCGG + Intergenic
1015993168 6:138969666-138969688 GCTGCATGTGCAACATGAGCTGG - Intronic
1016383723 6:143511619-143511641 GCTCCTGGGGCCGCATGTCCCGG + Exonic
1016648206 6:146434433-146434455 GCTGCAGCGGCAGCATCTGCAGG - Exonic
1017756295 6:157532076-157532098 GCCGCTGGGGGAGGAGGAGCAGG + Intronic
1018338066 6:162817146-162817168 GAGGCTGGGGCAGCCTGTGCCGG - Intronic
1018659379 6:166071879-166071901 ACTGCTGGGACAGCATGAGTTGG - Intergenic
1019716465 7:2541619-2541641 GGTGCTGGGGCAGCAAGGGGTGG + Intronic
1019729486 7:2622459-2622481 GGAGCTGGGGCAGGAGGAGCTGG - Intergenic
1019729491 7:2622474-2622496 TTTGCTGGGGCAGGAGGAGCTGG - Intergenic
1019729496 7:2622489-2622511 GCAGCTGGGGCAGGATTTGCTGG - Intergenic
1019729504 7:2622519-2622541 GCAGCTGGGGCAGGAGGAGCTGG - Intergenic
1019729509 7:2622534-2622556 GCAGCTGGGGCAGGAGCAGCTGG - Intergenic
1019729513 7:2622549-2622571 GCAGCTGGGGCAGGAGCAGCTGG - Intergenic
1019729529 7:2622609-2622631 GGAGCTGGGGCAGGAGGAGCTGG - Intergenic
1020958481 7:14772880-14772902 GCTGAAGGGGAAGGATGAGCAGG - Intronic
1021610644 7:22454673-22454695 GCTGCAGGTGCTGCAGGAGCTGG + Intronic
1022493636 7:30839480-30839502 GTGGCTGGTGCAGCAAGAGCTGG + Intronic
1023401628 7:39795831-39795853 GCTGCTGGGGCAGTATGGGCAGG - Intergenic
1023772301 7:43568900-43568922 GCTGGTGAGGAAGCATGGGCAGG + Intergenic
1024075609 7:45816453-45816475 GCTGCTGGGGCAGCATGAGCAGG - Intergenic
1024237252 7:47408005-47408027 TCAGCTGGGGCAGCAAGAGGCGG + Intronic
1024238917 7:47418978-47419000 GCTGCAGGGGCAGCACCAACCGG + Intronic
1024247370 7:47480342-47480364 GCTGCTGGGGAAGTGTGTGCAGG - Intronic
1024338527 7:48234214-48234236 GCTGCTGGGGCAGGGTGAGCGGG + Intronic
1024495498 7:50041218-50041240 GCTGCGGGTGCAGCTTCAGCAGG + Intronic
1024520377 7:50300596-50300618 GCTGCTGGGGGTGAAGGAGCAGG - Intergenic
1024647990 7:51384844-51384866 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
1025051844 7:55739343-55739365 GCTGCTGGGGAAGCATGAGCAGG + Intergenic
1025128802 7:56365011-56365033 GCTGTTGGGGCAGCATGAGCAGG + Intergenic
1025177183 7:56807889-56807911 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
1025258288 7:57399841-57399863 GCTGCAGGAGCCGCAGGAGCTGG + Intergenic
1025610347 7:63071889-63071911 GCTGCAGGAGCTGCAGGAGCTGG - Intergenic
1025694609 7:63768497-63768519 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
1026179893 7:68029721-68029743 TTTGCTAAGGCAGCATGAGCAGG - Intergenic
1027746735 7:82084524-82084546 GCTGCTGTGAGACCATGAGCAGG - Intronic
1029312176 7:99677647-99677669 TCAGCAGGGGCAGCATGAGCAGG + Intronic
1029356679 7:100057285-100057307 GCTCCTGGGGCAGGATGGTCAGG - Exonic
1029537012 7:101163034-101163056 GCTGCAGGAGCAGGAGGAGCTGG - Exonic
1029736649 7:102469101-102469123 GCTACTGGGGCAGCAGGACAGGG - Intronic
1032052134 7:128656200-128656222 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
1032554706 7:132819837-132819859 GCTGCGGGGGCAGCGTGAGCCGG + Intronic
1033159204 7:138981573-138981595 GCGGCCGGGGCAGCGTGCGCGGG + Intergenic
1033356883 7:140607367-140607389 GAGGCTGGGGAACCATGAGCTGG + Intronic
1033543241 7:142376309-142376331 GAGGCTGGGGCAGCAAGGGCTGG + Intergenic
1034293079 7:149947637-149947659 GGGGCTGGGGCAGCGTGTGCAGG + Intergenic
1034394215 7:150808016-150808038 GCAGCTGGGGAAGCTTGAACTGG + Intergenic
1034812994 7:154149236-154149258 GGGGCTGGGGCAGCGTGTGCAGG - Intronic
1034919282 7:155066063-155066085 CCTGCTGGTGCCGCATCAGCTGG + Intergenic
1035194676 7:157206819-157206841 GCTGCTGTGAAAGCAGGAGCAGG + Intronic
1035312409 7:157977812-157977834 GCTGCTGGGGGAGCAGGAAGGGG + Intronic
1035544972 8:473356-473378 ACTGCTGGGGGTGCATGTGCAGG - Intergenic
1035901801 8:3465133-3465155 GCTGCTGGGGCCTCACCAGCAGG + Intronic
1037770279 8:21794869-21794891 GCTGCTGGGGCAGGCTGGGTGGG + Intronic
1037815054 8:22107725-22107747 GCTCTTGGGGCAGAATGAGAGGG + Exonic
1038017944 8:23530374-23530396 GATGCTGGTCCTGCATGAGCAGG + Intronic
1040621457 8:49096832-49096854 GCTGCTGGGGCATCCTGGCCTGG - Intergenic
1041687379 8:60657001-60657023 GCTGCTCTGGCATCATGACCTGG + Intergenic
1042107922 8:65348581-65348603 CTGGCTGGGGCAGCAGGAGCAGG + Intergenic
1043174581 8:77008656-77008678 ACAGCTGGAGAAGCATGAGCTGG + Intergenic
1043982422 8:86657724-86657746 GCTGCAGGAGCTGCAGGAGCTGG - Intronic
1045151737 8:99415995-99416017 GCTGTGGGCGCAGCATCAGCAGG - Intronic
1045184505 8:99823430-99823452 GCTGCTGGGAGACCATGAGGAGG + Intronic
1045245033 8:100435359-100435381 GTGGCTGGGGCAGCCTGAGATGG + Intergenic
1046645768 8:116783805-116783827 GATGGGGAGGCAGCATGAGCAGG - Intronic
1048188179 8:132263494-132263516 GAGGCTGGGGCTGGATGAGCTGG + Intronic
1048697957 8:137049782-137049804 GCTGCTGGAGCTGCTGGAGCTGG - Intergenic
1048875393 8:138833239-138833261 TCTCCTGGGGCAGGATGGGCAGG - Intronic
1049168148 8:141139798-141139820 GCTGCTGGGAAGGCAGGAGCAGG - Intronic
1049409110 8:142464624-142464646 GCTGCTGGCGCCGCATCTGCAGG - Exonic
1049417814 8:142503541-142503563 GCTGCAGGTGCAGCAGGTGCGGG + Intronic
1049608158 8:143539260-143539282 GCTGCTGGGGTACCAGGGGCCGG + Exonic
1051792515 9:20823053-20823075 GCTGCTGGAGTAGCTTGATCAGG - Exonic
1052030110 9:23618937-23618959 GTTGCTGGAGCAGAGTGAGCAGG - Intergenic
1052800050 9:32958272-32958294 GCAGCTGGGGAAGCTTGAACTGG + Intergenic
1052813470 9:33082132-33082154 CCAGCTGGTGGAGCATGAGCAGG - Intergenic
1054804468 9:69384570-69384592 GCTGCTCGGGCAGCATGACCTGG - Intronic
1054893851 9:70284846-70284868 TCTGCTGGAACAGAATGAGCAGG - Intronic
1055302485 9:74896847-74896869 GCTGCAGGGGCTGCCTGAGGAGG - Intergenic
1055661628 9:78509388-78509410 CCTCCTGGGGAAGGATGAGCAGG + Intergenic
1056803259 9:89708637-89708659 GATGCTCAGGCGGCATGAGCTGG - Intergenic
1056947111 9:91007315-91007337 GCAGCTGGGGCAGAAGCAGCTGG - Intergenic
1057214579 9:93220792-93220814 GATGCTGGGGCAGCACGGGCAGG - Intronic
1057484907 9:95475374-95475396 TCTGCTTGGGCAGCCTGAGAGGG + Intronic
1057804492 9:98210717-98210739 GCTGCTGAGGCAGCTTGTCCAGG - Exonic
1058621240 9:106885673-106885695 TCTGCTGGGGCAGCTGGAACTGG - Intronic
1059769834 9:117414803-117414825 GCGGCGGCGGCAGCAGGAGCAGG + Exonic
1060820963 9:126661496-126661518 GTTTGTGGGGCAGCAGGAGCAGG + Intronic
1060827130 9:126693799-126693821 GCGGCTGGGCCAGGGTGAGCCGG + Exonic
1060884768 9:127143298-127143320 ACTGCTGGAGCAGGGTGAGCTGG - Intronic
1060886213 9:127154245-127154267 GCTGCTGGGCCAGCTGGATCTGG + Intronic
1061062455 9:128257498-128257520 GCTGCTGGAGCTGCAGGAGCTGG - Exonic
1061411191 9:130422589-130422611 GGAGCTGGGGCAGCATGACTGGG + Exonic
1061824846 9:133251844-133251866 GCAGCTGGGGCATCATCAGTTGG - Intronic
1062035078 9:134379387-134379409 GCTTCTGGGGCACCCTGAGATGG + Intronic
1062391647 9:136336283-136336305 GCTGCAGTGTCAGCATGGGCTGG - Intronic
1062533780 9:137012828-137012850 ACTGCTGGGGCAGGAGAAGCCGG + Exonic
1062754873 9:138281790-138281812 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
1203578781 Un_KI270745v1:25959-25981 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
1186195869 X:7110029-7110051 GCTGCAAGGGCAGCATGGGGAGG + Intronic
1186477240 X:9866990-9867012 CCTGCAGTGGCAGCATGAGGGGG - Intronic
1186626459 X:11298814-11298836 GTGGCTGGGGCTGCATGGGCTGG - Exonic
1189482739 X:41405728-41405750 GCAGCTGGAGCAGAGTGAGCCGG - Intergenic
1189892009 X:45612733-45612755 GTGGCTGGGGCAGCAGGGGCTGG - Intergenic
1190726756 X:53194954-53194976 GCTGCTGGGGCTGTCTGCGCAGG - Exonic
1194134663 X:90126148-90126170 GATTCTGGGGGAGCATGTGCAGG + Intergenic
1196951747 X:120931523-120931545 GCCTCTGGGGCAGCAGCAGCGGG + Exonic
1196952431 X:120936384-120936406 GCCTCTGGGGCAGCAGCAGCGGG + Exonic
1196953116 X:120941245-120941267 GCCTCTGGGGCAGCAGCAGCGGG + Exonic
1196953801 X:120946105-120946127 GCCTCTGGGGCAGCAGCAGCGGG + Exonic
1196954486 X:120950966-120950988 GCCTCTGGGGCAGCAGCAGCGGG + Exonic
1196955169 X:120955826-120955848 GCCTCTGGGGCAGCAGCAGCGGG + Exonic
1196955856 X:120960709-120960731 GCCTCTGGGGCAGCAGCAGCGGG + Exonic
1196956538 X:120965570-120965592 GCCTCTGGGGCAGCAGCAGCGGG + Exonic
1196957220 X:120970430-120970452 GCCTCTGGGGCAGCAGCAGCGGG + Exonic
1196957902 X:120975290-120975312 GCCTCTGGGGCAGCAGCAGCGGG + Exonic
1196958584 X:120980150-120980172 GCCTCTGGGGCAGCAGCAGCGGG + Exonic
1196959265 X:120985010-120985032 GCCTCTGGGGCAGCAGCAGCGGG + Exonic
1198480221 X:137033922-137033944 GCTGCGGGCGCGGCAGGAGCGGG + Intergenic
1199911818 X:152295351-152295373 GCAGCTGGGGAAGCTTGAACTGG - Intronic
1200292628 X:154886881-154886903 GCAGCTGGGGCAGCTGGAGCTGG - Exonic
1200339472 X:155382621-155382643 GCAGCTGGGGCAGCTGGAGCTGG - Exonic
1200346998 X:155458072-155458094 GCAGCTGGGGCAGCTGGAGCTGG + Exonic
1200480444 Y:3696259-3696281 GATTCTGGGGGAGCATGTGCAGG + Intergenic
1200742377 Y:6868174-6868196 GTGGCTGGGGCTGCATGGGCTGG + Exonic
1202381403 Y:24278577-24278599 GCTGCTGGGGCAGCAAGGGCAGG - Intergenic
1202489382 Y:25391549-25391571 GCTGCTGGGGCAGCAAGGGCAGG + Intergenic