ID: 1024075918

View in Genome Browser
Species Human (GRCh38)
Location 7:45817790-45817812
Sequence TTCCCAGCACATGGCCGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024075918_1024075921 -10 Left 1024075918 7:45817790-45817812 CCTCACCGGCCATGTGCTGGGAA No data
Right 1024075921 7:45817803-45817825 GTGCTGGGAATGAGCAGCTCAGG No data
1024075918_1024075923 -6 Left 1024075918 7:45817790-45817812 CCTCACCGGCCATGTGCTGGGAA No data
Right 1024075923 7:45817807-45817829 TGGGAATGAGCAGCTCAGGTGGG No data
1024075918_1024075924 4 Left 1024075918 7:45817790-45817812 CCTCACCGGCCATGTGCTGGGAA No data
Right 1024075924 7:45817817-45817839 CAGCTCAGGTGGGCAGCAGCAGG No data
1024075918_1024075922 -7 Left 1024075918 7:45817790-45817812 CCTCACCGGCCATGTGCTGGGAA No data
Right 1024075922 7:45817806-45817828 CTGGGAATGAGCAGCTCAGGTGG No data
1024075918_1024075926 16 Left 1024075918 7:45817790-45817812 CCTCACCGGCCATGTGCTGGGAA No data
Right 1024075926 7:45817829-45817851 GCAGCAGCAGGGCTGCCCACTGG No data
1024075918_1024075925 5 Left 1024075918 7:45817790-45817812 CCTCACCGGCCATGTGCTGGGAA No data
Right 1024075925 7:45817818-45817840 AGCTCAGGTGGGCAGCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024075918 Original CRISPR TTCCCAGCACATGGCCGGTG AGG (reversed) Intergenic
No off target data available for this crispr