ID: 1024077553

View in Genome Browser
Species Human (GRCh38)
Location 7:45829807-45829829
Sequence CTGCAGAAGGGGCCTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024077553_1024077560 0 Left 1024077553 7:45829807-45829829 CCCTCCTCAGGCCCCTTCTGCAG No data
Right 1024077560 7:45829830-45829852 CCTCCTTTGTTATATGTGATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024077553 Original CRISPR CTGCAGAAGGGGCCTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr